Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | anti-TMEM63C | Perbio Science Germany; this paper | epitope: GLRGFARELDPAQFQEGLE | 1:1600 for rat tissue, 1:800 for human biopsies |
| Antibody | rabbit anti-WT1 | Santa Cruz | RRID:AB_632611 | 1:500 |
| Antibody | rabbit anti-nephrin | Abcam | RRID:AB_944400 | 1:750 |
| Antibody | Goat anti-rabbit EnVision HRP conjugate |
Dako | ||
| Antibody | GAPDH | Calbiochem | ||
| Antibody | AKT | Merck Chemicals GmbH | ||
| Antibody | phospho-AKT Ser473 | Merck Chemicals GmbH | ||
| Biological sample (Homo sapiens) |
Renal biopsy samples of patients with FSGS |
archive of the Department of Pathology of the Leiden University Medical Center (LUMC) |
For patient information see Table 4 |
|
| ell line (Homo sapiens) |
hPC | Saleem et al., 2002 | RRID:CVCL_W186 | |
| Gene (Danio rerio) |
tmem63c | NA | ZFIN: ZDB-GENE-120928–2 | |
| Gene (Homo sapiens) |
TMEM63C | NA | Ensembl: ENST00000298351.4 | |
| Gene (Rattus norvegicus) |
Tmem63c | NA | Ensembl: ENSRNOT00000015571.6 | |
| Other | DAPI stain | Sigma Aldrich | stock solution 1 mg/ml diluted 1:2000 in PBS |
|
| Other | DNA-Seq database | this paper | GEO and SRA: Submission ID: SUB2950675 and BioProject ID: PRJNA398197 |
See Data availability |
| Other | RNA-Seq database | this paper | GEO and SRA: accession GSE102546 |
See Data availability |
| Recombinant DNA reagent |
tmem63c
(cDNA) zebrafish |
this paper | Infusion cloning primer sequences for cDNA synthesis: forward: GCTTGATATCGAATTCATGGCGTTTGAGTCCTGGCCTGC; reverse: CGGGCTGCAGGA ATTCTCACTGAAAAGCCACCGGACTG; Sequence additional primer for amplification of ORF: GTGCAGAAACTAATGAAGCTGG; Progenitors: tmem63c (cDNA); pBluescript II SK(+) |
|
| Sequence- based reagent |
tmem63c
ATG-MO |
Gene Tools LLC Philomath |
sequence: 5’-CAGGCCAGGACTCAAACGCCATTGC-3’ | |
| Sequence- based reagent |
tmem63c
ex2-sdMO |
Gene Tools LLC Philomath |
sequence: 5'-TGTTATCATAGATGATGTACCAGCC-3' | |
| Sequence- based reagent |
tmem63c
ex2-sgRNA |
this paper | Sequence synthesis forward primer with CRISPR target site underlined: GAAATTAATACGACTCACTATAGGACGTCAGGAGTTTCCTGAGTT TTAGAGCTAGAAATAGC |
|
| Sequence- based reagent |
tmem63c ex2- sgRNA primers flanking CRISPR target site |
BioTez Berlin-Buch GmbH | Sequences: forward: CAAATGGTGAACACTTGTGAATC, reverse: CTGCGGTTTACTGCGGAGATG | |
| Sequence-based reagent |
siTMEM63C | Sigma-Aldrich Chemie GmbH | ||
| Strain, strain background (Danio rerio) |
Tg(fabp10a:gc-EGFP) | Zhou and Hildebrandt, 2012 | ||
| Strain, strain background (Danio rerio) |
Tg(wt1b:GFP) | Perner et al., 2007 | ||
| Strain, strain background (Rattus norvegicus) |
MWF/Rkb | Own colony Charité – Universitätsmedizin Berlin, Germany |
http://dels.nas.edu/ilar/ (laboratory code Rkb); Schulz and Kreutz, 2012; RRID:RGD_724569 |
|
| Strain, strain background (Rattus norvegicus) |
SHR/Rkb | Own colony Charité – Universitätsmedizin Berlin, Germany |
http://dels.nas.edu/ilar/
(laboratory code Rkb); Schulz and Kreutz, 2012; RRID:RGD_631696 |
|
| Strain, strain background (Rattus norvegicus) |
MWF-6SHR | Own colony Charité – Universitätsmedizin Berlin, Germany |
http://dels.nas.edu/ilar/
(laboratory code Rkb); Schulz and Kreutz, 2012; RRID:RGD_1641831 |
|
| Strain, strain background (Rattus norvegicus) |
Congenic strains see Figure 1 | Own colony Charité – Universitätsmedizin Berlin, Germany; this paper |
For generation of congenic strains seeMaterials and method section |