Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2020 May 1.
Published in final edited form as: J Immunol. 2019 Mar 25;202(9):2806–2816. doi: 10.4049/jimmunol.1801359

Leukemic B Cell CTLA-4 Suppresses Co-stimulation of T cells

Priscilla Do 1, Kyle A Beckwith 1, Carolyn Cheney 2, Minh Tran 2, Larry Beaver 2, Brittany G Griffin 3, Xiaokui Mo 4, Yang Liu 5, Rosa Lapalombella 2, Erin Hertlein 2, Natarajan Muthusamy 2,*, John C Byrd 2,*
PMCID: PMC6478536  NIHMSID: NIHMS1522618  PMID: 30910862

Abstract

Clinical benefit of CTLA-4 blockade on T cells is known, yet the impact of its expression on cancer cells remains unaddressed. We define an immunosuppressive role for tumor expressed CTLA-4 using chronic lymphocytic leukemia (CLL) as a disease model. CLL, among other cancer cells, are CTLA-4+. Co-culture with activated human T cells induced surface CTLA-4 on primary human CLL B cells. CTLA-4 on CLL-derived human cell lines decreased CD80 expression on co-cultured CD80+ cells, with restoration upon CTLA-4 blockade. Co-culture of CTLA-4+ CLL cells with CD80-GFP+ cell lines revealed transfer of CD80-GFP into CLL tumor cells, similar to CTLA-4+ T cells able to trans-endocytose CD80. Co-culture of T cells with CTLA-4+ CLL cells decreased IL2 production. Using a human CTLA-4 knock-in mouse lacking FcγR function, anti-tumor efficacy was observed by blocking murine CTLA-4 on tumor cells in isolation of the T cell effect and Fc-mediated depletion. These data implicate tumor CTLA-4 in cancer cell-mediated immunosuppression in vitro and to have a functional role on tumor cells in vivo.

Introduction

Cytotoxic T Lymphocyte Antigen 4 (CTLA-4) critically mediates T cell responses by acting as a dimmer switch to balance T cell activation and inhibition(1-3). Clinically targeted through blockade of CTLA-4 as an immunostimulatory treatment for cancer (ipilimumab) and administration of soluble CTLA-4 (abatacept) to enhance immunosuppression as a treatment for autoimmunity, this protein’s biology has become a major area of investigation in broadly applicable settings(4-6). The last two decades has shown intense study of CTLA-4 as a T cell protein despite multiple reports that CTLA-4 is expressed by both normal B cells and select tumor types(7-9). In fact, expression of CTLA-4 on T cells is not currently used as a prognostic indicator for response to ipilimumab treatment, likely owing to the complex biology of CTLA-4 but additionally, to unknown contributions of CTLA-4 expressed by the tumor or alternative immune effector cells. The consequences of non-T cell CTLA-4 is poorly defined.

Genetically engineered CTLA-4 loss in mouse models has demonstrated its extreme potency as a negative regulator of T cell immunity(10, 11). Loss of CTLA-4 leads to lymphoproliferative-like T cell disease, immune-mediated destruction of multiple organs, and premature death of the mice at 3-4 weeks old. Conditional knock out of CTLA-4 on T regulatory cells (Tregs) is sufficient to mimic lymphoproliferative-like T cell disease, immune-mediated organ destruction, and early death of mice, although delayed to 8 weeks old(12). In humans, Tregs comprise a rare portion of CD4+ T lymphocytes (~1-2%), CD4+ T-cells account for ~50% of lymphocytes, and lymphocytes account for ~23-33% of leukocytes (13, 14). The potency of CTLA-4 on this rare subset of T cells points to the importance of studying the function of CTLA-4 on tumor cells, which would largely outnumber the levels of Tregs.

While no direct signaling pathway for CTLA-4 exists, it is heavily supported that CTLA-4 antagonizes co-stimulation of naïve T cells to effector T cells by competing with the CD28 co-stimulatory molecule on T cells(15-17). This function occurs via down-modulation of the shared T cell co-stimulatory ligands CD80 and CD86. Down-modulation is regulated via CTLA-4 binding and/or removal from the cell surface through trans-endocytosis. Lack of CD80/CD86 renders antigen presenting cells (APCs) less capable of activating the CD28 T cell co-stimulatory pathway. Recently, tumor expressed CTLA-4 was reported to associate with worse prognosis in nasopharyngeal carcinoma and shorter overall survival esophageal carcinoma(18, 19). In CLL, CTLA-4 is expressed by tumor cells and is positively correlated with stages indicative of progressive disease(20). A comparison of autologous peripheral blood, lymph nodes, and bone marrow identified CTLA-4 (in tumor B-cells) as part of a gene signature that was associated with disease progression(21). CTLA-4 was upregulated in the lymph nodes, a site of leukemic B cell proliferation. Due to CTLA-4’s capacity as an extrinsic regulator and potent influence on skewing immune homeostasis, we hypothesized that tumor cell expressed CTLA-4 is capable of potentiating immunosuppression. Indeed, immunosuppression is a major contributor to the morbidity and mortality of CLL.

It has yet to be rigorously demonstrated that CTLA-4 on tumor cells has relevance to the disease, immunosuppression, or perhaps to therapy. Using CLL as a model disease, we show that leukemic B cell expressed CTLA-4 is able to decrease CD80 from neighboring cells leading to suboptimal co-stimulation and reduced IL2 production in vitro. Blockade of tumor CTLA-4 in vivo is capable of reducing leukemic burden.

Materials and Methods

Primary Human Samples and Cell Lines

Patient blood was obtained in ACD tubes at The Ohio State University with consent and in accordance with the Declaration of Helsinki. B and T-cells were negatively selected using RosetteSep (StemCell Technologies) and ficoll. The Mec1 cell line was obtained from DSMZ and the OSU-CLL cell line from The Ohio State University(22, 23). Except for where directly indicated that cells had been frozen, all cells used were freshly isolated. Normal donor cells were collected using the same methods as patient cells from fresh blood (volunteers or Redcross). Mec1 and OSU-CLL were maintained in RPMI 1640 (10% FBS+56U/mL penicillin+56μg/mL streptomycin+2mM L-glutamine). Hek293 (ATCC) and Phoenix Ampho (Orbigen) cells were maintained in DMEM (10% FBS+56U/mL penicillin+56μg/mL streptomycin +2mM L-glutamine).

Real time qPCR

RNA was isolated using Trizol (Invitrogen), alcohol precipitation, and column purification (Qiagen). cDNA was prepared using random hexamers and MMLV reverse transcriptase (Invitrogen). Taqman assays were used for RT-qPCR (Applied Biosystems).

Plasmids

The pRetro-tight-pur system was used to produce dox-inducible CTLA-4 or empty vector B-cell lines (Clonetech). Full length CTLA-4 cDNA (sequence NM_005214.3) was obtained from Origene, restriction digested with NotI, and ligated into pRetro. The CTLA-4pRetro or empty vector retro viral plasmids were packaged by Phoenix cells, supernatant collected and 0.45μm filtered. Tet+ Mec1 and OSU-CLL cell lines were infected with CTLA-4pRetro or empty vector virus and selected using 1μg/mL puromycin+500μg/mL G418. CD80-GFP and CD86-GFP plasmids were obtained from Origene and stably transfected into Hek293 cells using calcium phosphate (Promega) and selected with 500μg/mL G418. Full length CTLA-4, CD80, and CD86 sequence inserts were all validated by Sanger Sequencing at the OSU Nucleic Acid Shared Resource Core facility. Primers for sequencing: VP1.5 F: 5’ GGACTTTCCAAAATGTCG 3’, XL39 R: 5’ ATTAGGACAAGGCTGGTGGG 3’, RetroF: 5’ ATTAGGACAAGGCTGGTGGG 3’, 5’ATCTGAGGCCCTTTCGTCTTCACTC 3’, RetroR: 5’ TGTGTGCGAGGCCAGAGGCCACTT 3’, Nested CTLA-4 F: 5’ GACCTGAACACCGCTCCCATAAAGC 3’, Nested CD86GFP F: 5’ GCCTCCCCCAGACCACAT 3’, Nested CD86GFP R: 5’ GGTGCTCTTCATCTT GTTGGTCAT 3’

Antibodies and Reagents

Anti-human antibodies CTLA-4 (Clone BNI3; PE, APC, or BV421), CD80 (Clone L307.4, FITC, PE, V450), CD86 (Clone 2331/FUN-1 PE, PerCP-Cy5.5), CD69 (Clone FN50-V450, TP1.55.3-PE), CD19 (Clone HIB19 FITC, AF647), CD5 (Clone UCHT2 APC), CD3 (Clone UCHT1; ECD, AF700), and Isotype controls (PE, APC) were obtained from BD Biosciences, Biolegend, and Beckman Coulter. Violet and Near IR live/dead stains (Life technologies) and claret membrane dye (Sigma) were used for flow cytometry. Anti-murine CTLA-4 (Clone UC10-4F10-11, PE), CD19 (Clone 1D3 AF647), and CD5 (Clone 53-7.3 FITC, BV421) and human or murine Fc block were purchased from BD Biosciences. Cells were surface stained in flow buffer (5%FBS, 0.1% NaN3) and fixed and permeabilized for intracellular staining using BD Cytofix/cytoperm. Intracellular stains were in BD perm/wash buffer. T-cells were stimulated with 10 μg/mL plate bound anti-CD3 (ebioscience) +/− 1 μg/mL soluble anti-CD28 (eBioscience) or 1:1 Beads:T-cells anti-CD3/CD28 dynabeads (Gibco). Ipilimumab was obtained from the OSU Pharmacy.

Flow Cytometry

Cells were analyzed on an FC500 (Beckman Coulter), Gallios (Beckman Coulter), or LSR Fortessa (BD). Adherent cells were removed from the plate using Accutase (Gibco). Dynabeads were removed using a dynabead magnet and washed 1x with PBS. Briefly, cells were surfaced stained for 15-20min at room temp or on ice, respectively, in either PBS or flow buffer (5%FBS+0.1%NaN3) depending on the stains used. Where applicable, surface staining was followed by 20min fixation and permeabilization (BD Cytofix/cytoperm) on ice and 30min intracellular staining in BD perm/wash buffer. Mouse peripheral blood analysis was performed by whole blood staining for 15min at 4⁰C, red blood cells lysed (eBioscience), no wash, and countbrite beads (Life Technologies) added prior to obtaining absolute lymphocyte counts.

B-T co-culture

Cells were plated at a 1:1 ratio of B:T-cells (except in autologous experiments 1:1- 2.5:1 B:T) and at 3-5e6 cells/mL. Surface CTLA-4 expression was determined by flow cytometry at 48h. For Mec1/ T-cell co-cultures, Mec1 cells were treated +/− doxycycline and +/− 10 μg/mL Ipilimumab for 24h and washed 2x prior to co-culture at a 1:1 ratio of Mec1:T-cells. Cells were gated on live/lymphocytes by FS/SS/ CD19+/CD5+ or Singlets/live/Claret+ for CLL B-cells. Where cytokines were assessed, supernatant was collected at 48h and frozen at −80⁰C. Supernatants were assessed for cytokines using the Th1/Th2/Th17 human cytokine bead array (CBA; BD Biosciences) and analyzed using a 5-parameter logistic curve using FCAP Array software (Softflow). Purity after cell isolation was assessed via flow cytometry prior to all co-cultures and staining B cells with Claret membrane dye (Sigma).

Trans-endocytosis Assay

For cell lines, 1e6 cells/mL Mec1 were treated +/− 1μg/mL Dox and +/− Ipilimumab for 24h and washed, stained for surface CTLA-4 expression and measured by flow cytometry, and resuspended at 1e6 cells/mL prior to 4h co-culture with CD80-GFP Hek293 or CD86-GFP Hek293 stably transfected cell lines. Hek293 cells were plated overnight in 100mm culture dishes at 50% confluency before co-culture. Mec1 and Hek293 were co-cultured for 4h and stained for flow cytometry. For primary cells, previously RosetteSep isolated and cryo-preserved CLL B-cells were co-cultured with allogeneic T-cells plus anti-CD3/anti-CD28 activating dynabeads for 48h. Following co-culture with GFP+ Hek293 cell lines, lymphocytes were stained and GFP transfer measured by flow cytometry. Primary CLL B cells were assessed for surface CTLA-4 expression by flow cytometry and resuspended at 3e6 cells/mL prior to 18h co-culture with CD80-GFP Hek293 or CD86-GFP-GFP Hek293 stably transfected cell lines. Surface expression of CD80 and CD86 and co-expression of GFP by Hek293 cells was measured as a control for each assay.

Antibody Specificity Assay

Protein binding aldehyde/sulfate latex beads (Life Technologies) were coated with 1μg murine recombinant his-tagged CTLA-4 or 1μg human recombinant his-tagged CTLA-4 (Life Technologies). Protein was detected using commercial flow antibodies compared to isotype controls for murine or human CTLA-4 (BD Biosciences). In vivo monoclonal antibody to murine CTLA-4 (clone 9d9, BioXCell) compared to isotype control (MPC-11, BioXCell) was detected for specificity to murine CTLA-4 and no cross-reactivity to human CTLA-4 using a secondary anti-mouse IgG2b APC antibody (Abcam) and analysis by flow cytometry.

Mice

All animal studies were approved by the Institutional Animal Use and Care Committee at the Ohio State University. Eμ-TCL1 mice were received from Dr. Carlo Croce and backcrossed to C57BL/6 (24, 25). C57BL/6 human CTLA-4 knock-in mice were received from Yang Liu (Children’s Hospital, Washington DC)(26). FcRγ KO mice were received from Jeanette Leusen (University Medical Center, Netherlands)(27). C57BL/6N human CTLA-4 +/+ mice were bred with C57BL/6N FcRγ −/− mice to produce human CTLA-4 +/− FcRγ +/− mice. Heterozygous mice were crossed to produce CTLA-4+/+ FcRγ −/− mice. 1e7 TCL1 cells were engrafted by tail vein injection. Anti-CTLA-4 (9D9, BioXcell) or isotype control (MPC-11, BioXcell) were administered via intraperitoneal injection at 100μg/dose on days 0, 3, 6, 9, and 12 post leukemia diagnosis (previously defined as ≥ 20% CD19+CD5+ of CD45+ cells) in a blinded and randomized manner(28). Peripheral blood was collected by submandibular bleed on a weekly basis. Mice were euthanized based on standard early removal criteria (respiratory distress, rough coat, weight loss, lethargy, etc.) as stated in an approved protocol by The Ohio State University Institutional Animal Care and Use Committee. Genotypes of all mice were confirmed by PCR using the following primers 5’>3’: hCTLA-4 F (CAC CAA TGT TGG GGA GTA G), mCTLA-4 F (CTT GTC CCT TTG ATG GCA CT), common CTLA-4 R (GGT TCT GGA TCT GCA ACA GAA), Neo F (AAG ATG GAT TGC ACG CAG GT), Neo R (TCG ATG CGA TGT TTC GCT TG), mFcRγ F (GCC CTT CCC TTC CCT CTA CA), mFcRγ R (CCT TCA GAC CAT GGG GAA CC), hFcRγ F (CCA GTT CCA GAG ACC TGA GC), hFcRγ R (CAC CAA CAC ACA CAC ACC AA).

Statistical analysis

For in vitro studies, data were analyzed by mixed effect model, incorporating repeated measures for each experiment. For in vivo lymphocyte count studies, data were analyzed by mixed effect model and repeated measures were incorporated for each subject, followed by comparisons between groups at each time point. For in vivo survival, Kaplan-Meier estimates of the survival function were generated for both groups, and the log-rank test was used to compare the curves.

Results

CLL: A Disseminated Cancer which Expresses CTLA-4

CLL has profound immunosuppression as a central component of its pathogenesis. We initially noted by microarray that CTLA-4 expression in CLL B-cells (pool of N=5) as compared to normal B cells (pool of N=6) was the fifth most differentially expressed gene, average 19-fold change over normal B-cells (data not shown)(29). We validated this observation by examining transcript expression in CLL and normal B cell samples by RT-qPCR and the comparative CT method (Fig. 1A)(30). CTLA-4 was abnormally, constitutively expressed in CLL B cells whereas normal B cells did not express transcript (-ΔCt −2.774 CLL versus −12.03 NB, p<0.0001). We examined protein expression by flow cytometry and identified 17/28 (61%; ≥10%CTLA-4+) patients to have constitutive intracellular expression of CTLA-4 ranging from 0.15-96.34% positive cells compared to isotype control and significantly upregulated on average compared to normal B cells (p<0.0001). All patients (n=27) were negative for surface expression of CTLA-4 (Fig. 1 B-C). For 14 patients, mRNA and intracellular protein expression were available on the same patient. For these patient samples, all patients that tested positive for CTLA-4 protein by flow cytometry also had detetable CTLA-4 transcript by RT-qPCR, although no correlation between mRNA and positive intracellular protein expression of CTLA-4 was observed (Spearman correlation coefficient of −0.06, p=0.8398; data not shown). It is likely that multiple isoforms of CTLA-4 are detected transcriptionally that may cause discordance with protein expression. Both soluble and full length CTLA-4 transript are detectable with the primer/probe set used. While both isoforms are of interest and potential functional consequence, the focus of this study is on full length and not soluble CTLA-4. Confocal microscopy was performed to assess the cellular location of CTLA-4, and we observed CTLA-4 to be expressed in a punctate pattern within the cytoplasm, but absent from the nucleus (Fig. 1D). In agreement with the protein expression by flow cytometry, CTLA-4 was heterogeneously expressed and mimicked known expression patterns in T cells where activated T cells express variable levels of CTLA-4 as opposed to uniform expression. The Jurkat T cell line was negative for CTLA-4, consistent with known literature, and was used as a control(31, 32). Similar to human CLL, we examined primary CLL tumors from the TCL1 transgenic mouse. Interestingly, we detected surface CTLA-4 protein expression on CD19+CD5+ cells compared to both normal CD19+CD5- B cells from the same mice and compared to an isotype control (N=5, Fig. S1), consistent with supplementary findings in TCL1 control mice on B220lowCD19+ cells in prior literature(33). Contrasting with both primary human and murine CLL, EBV transformed cell lines (Mec1, OSU-CLL, OSU-NB, Ramos, Raji, and 697) lacked expression of CTLA-4 at both mRNA and protein levels (data not shown).

Figure 1. CLL: a disseminated cancer which expresses CTLA-4.

Figure 1.

Open in a new tab

a. RT-qPCR validation of CTLA-4 transcript CLL (N=16) vs. Normal B (N=10). b. Representative density plots of CTLA-4 intracellular protein expression validated via flow cytometry comparing CLL vs. Normal B. c. CTLA-4 surface (N=27) and intracellular/total (N=28) expression by flow cytometry, separated into IGHV mutational status (M vs. UM p=0.0627) and compared to normal B cell samples (N=8) as determined by flow cytometry gated on Live/CD19+ cells. CTLA-4 positivity was designated at ≥ 10% compared to an isotype control (set at ~1% or less). d. Cellular localization of CTLA-4 within primary CLL cells via confocal microscopy (N=2, CLL 1 M, CLL 2 UM). CTLA-4 negative Jurkat cell line was used as a negative control. Comparisons between groups were analyzed by Wilcoxon two-sample t-test. Error bars represent mean ± SEM. (UM= IGHV unmutated, M= IGHV mutated)

Surface CTLA-4 can be detected on CLL B cells by co-culture with activated T cells

There is currently no known role for intracellular CTLA-4 in any cell type, including in CLL or other cancer cells, prompting us to hypothesize that this protein could be expressed on the cell surface. We used multiple B cell activating factors (CpG, PMA/Ionomycin, anti-IgM, IL4, CD40L, IL4+CD40L, LPS, IL4+LPS) to mimic activation-induced expression of CTLA-4 on T-cells, but found that activating CLL B cells did not result in surface localization (data not shown). In contrast, culture with activated T cells or activated T cell membranes have been published to result in detection of surface CTLA-4 on normal B cells, and we found that this was also true with CLL B-cells(7, 9). Co-culture with activated T-cells (anti-CD3/CD28 stimulated) for 48 hours induced surface expression of CTLA-4 on tumor CLL cells ≥ 5% CTLA-4+ in 9 patient samples and <5% CTLA-4+ in 3 samples where CLL only vs. CLL+T were not significantly different in CTLA-4 positivity p=0.5664 and CLL+T without stimulation vs. CLL+T+ anti-CD3/anti-CD28 stimulation was significantly different at p<0.0001 in either allogeneic or autologous co-culture conditions (Fig. 2A-B). Additionally, this expression required cell-cell contact when CTLA-4+ was detectable with activated T cell co-culture (N=6, p=0.0233) as determined by trans-well experiments (Fig. 2C). While induced surface CTLA-4 expression appears relatively modest for most samples tested, comparatively, surface CTLA-4 on T cells is known to be limited and highly regulated in comparison to intracellular stores, for example, with reported surface expression on murine T cells after activation approximated at 9-22% positivity(34-38). With a large ratio of leukemic cells to T cells, this suggests a non-negligible effect of leukemic cell CTLA-4, even at low levels, if tumor cell CTLA-4 has functional capacity.

Figure 2. Surface CTLA-4 can be induced on CLL B cells by co-culture with activated T cells.

Figure 2.

Open in a new tab

a. Representative flow plot of surface expression of CTLA-4 induced on Single cell/Live/Claret+ CLL B cells after 48h co-culture with anti-CD3/CD28 stimulated allogeneic T cells. b. Induction of surface CTLA-4 on primary CLL cells co-cultured with allogeneic or autologous T cells stimulated with anti-CD3/CD28 for 48h compared to CLL cells cultured alone or with unstimulated T cells (N=12 total with 3 UM CLL, 8 M CLL, and 1 NA, p<0.0001,). c. Induction of surface CTLA-4 at 48h +/− cell-to-cell contact, separated by a 0.4μm transwell insert, average induction of surface CTLA-4 at 48h (N=6, p=0.0233). Co-culture data were analyzed by the mixed effect model and soluble vs. contact data were analyzed by paired t-test. Error bars represent mean ± SEM. (UM= IGHV unmutated, M= IGHV mutated, NA=not available)

CLL Surface CTLA-4 can functionally reduce CD80 expression

To determine if tumor cell expressed CTLA-4 is functional, we established two CLL-derived leukemic B-cell lines (Mec1 and OSU-CLL) to express doxycycline-inducible CTLA-4 and empty vector controls to further our studies (Fig. 3A and data not shown). Mec1 and OSU-CLL are negative for CTLA-4 and express high levels of the ligands for CTLA-4, CD80 and CD86, making them appropriate models for studying CTLA-4 function in the context of cognate ligand. Known leakiness of the pRetro system resulted in detectable transcript levels of CTLA-4 without doxycycline induction of the CTLA-4pRetro Mec1 cells; however, this baseline level of transcript led to minimal intracellular protein and no detectable surface CTLA-4 protein. Upon doxycycline-induction of CTLA-4, CTLA-4 is surface expressed on these cell lines without the help of activated T-cell co-culture. Both of these CTLA-4 expressing cell lines are able to bind the soluble cognate ligand, CD80, when CTLA-4 is expressed on the surface (data not shown). We found that in the condition where surface CTLA-4 was expressed compared to the doxycycline-un-induced cell line or the empty vector control +/− doxycycline, CD80 was consistently down-modulated on the Mec1 cell line by an average ΔMFI of 10.5, p<0.0001, and that this phenotype was reproducible in the OSU-CLL cell lines as well (Fig. 3B, Fig. S2). Blockade of CTLA-4 on the Mec1 cell line with therapeutic reagent, Ipilimumab, restored CD80 expression with a significant increase in average MFI from 6.873 up to 13.987, p<0.0001 (Fig. 3B). We used RT-qPCR to assess if transcriptional changes in CD80 were responsible for changes in protein expression, but there were no significant differences between CTLA-4+ Mec1 versus any of the controls (Fig. 3C). This finding suggests that CTLA-4 may have function on tumor cells similarly to known blockade and/or co-stimulatory protein down-modulatory function on T cells.

Figure 3. Surface CTLA-4 reduces CD80 expression.

Figure 3.

Open in a new tab

The Mec1 cell line was transfected with a dox-inducible empty vector or CTLA-4 vector. a. CTLA-4 detection by flow cytometry intracellularly and on the surface of the Mec1 CTLA-4 cell or empty vector control +/− dox. b. CD80 on Mec1 cells +/− CTLA-4 detected by flow cytometry (Gating: Singlets>Live cells). Modulation of CD80 +/− 10 μg/mL ipilimumab (N=3). c. RT-qPCR measured CD80 transcript in the dox-inducible Mec1 CTLA-4+ cell line vs. untreated cells or empty vector controls (N=3 independent experiments). Data were analyzed by the mixed effect model, incorporating repeated measures for each experiment. Error bars represent mean ± SEM. (UT= untreated; * p<0.0001)

CD80 can be transferred from CD80-GFP+ cells to leukemic cells

We next checked the reported mechanism by which CTLA-4 on T-cells is able to down-modulate CD80 and/or CD86: trans-endocytosis(17). We stably transfected Hek293 cells to express C-terminal tagged CD80-GFP or CD86-GFP and co-cultured these cells with the CTLA-4+ doxycycline-inducible Mec1 cell line and measured uptake of GFP into the CTLA-4+ cell line (Fig. 4A-B and data not shown). Using the Mec1 CTLA-4+ or Empty Vector cell lines +/− dox, we determined that only the surface expressing CTLA-4+ cell line was able to receive CD80-GFP from the Hek293 cells after 4 hours of co-culture. We extended these studies to CLL cells co-cultured with the CD80-GFP or CD86-GFP Hek293 cells and again observed significant transfer of CD80-GFP by flow (average uptake of 27.78% GFP+ compared to co-cultured cells in the absence of CD80-GFP Hek293 cells) into primary CLL cells (N=10, p<0.0001) and T cells shown as an assay control. Although not statistically significant (p=0.2158), the transfer of CD80-GFP tended to decrease (6.06% drop in GFP+ cells) in a CTLA-4 dependent manner as evidenced when co-cultured in the presence of a CTLA-4 blocking antibody, ipilimumab (Fig. 4C-E). Within the same assay, this result was comparable to blockade of CTLA-4 on T cells and subsequent transfer of GFP (Fig.4E).

Figure 4. CD80 can be transferred from CD80-GFP+ cells to leukemic cells.

Figure 4.

Open in a new tab

a. Experimental design for measuring trans-endocytosis of CD80-GFP from stably transfected Hek293 cells into CTLA-4+ Mec1 cells b. Uptake of CD80-GFP from Hek293 cells into Mec1 Empty or CTLA-4 cell lines +/− dox after 4h of Mec1/Hek293 co-culture (Gating: Singlets> Live/CD19+) c. Experimental design for measuring trans-endocytosis of CD80-GFP into primary CLL and allogeneic T cells after inducing CTLA-4 onto the surface of CLL B cells d. Surface CTLA-4 expression was checked at 48h of CLL B+allogeneic T+anti-CD3/CD28 co-culture by flow followed by co-culture with Hek293 CD80-GFP cells for 18h +/− 10 μg/mL ipilimumab. GFP uptake measured by flow was gated on Singlets>Live cells>CD3+ or CD19+, representative flow plots for 1 patient. e. Average transfer of CD80-GFP and CD86-GFP into primary CLL B cells (CLL N=10, p<0.0001) and T cell controls +/− 10 μg/mL ipilimumab (CLL N=10, p=0.2158). Data were analyzed by the mixed effect model.

Diminished CD80 expression mediated by CTLA-4 reduces T cell IL2 production

Because CD80 and CD86 are necessary for T cell co-stimulation, we subsequently studied the consequences of CD80 down-modulation by tumor expressed CTLA-4 in a mixed lymphocyte reaction. We co-cultured CTLA-4+ Mec1 cells and allogeneic primary T cells from normal donors. Normal donor T cells were activated in a co-culture with Mec1 cells as detected by up regulation of CD69 at 48h (data not shown). Supernatant was collected at 48h of co-culture and IL2 measured by flow cytometry using a cytokine bead array. IL2, likely produced by the allogeneic T cells (N=3), was significantly decreased with tumor CTLA-4 expression at p=0.0172 (Fig. 5A). We noted that the mixed lymphocyte reaction with the Mec1 CTLA-4 vector led to more IL2 production than the empty vector Mec1 cell line. This effect is likely due to differences in the resulting clones post-selection, and as a result, we compared the most relevant conditions (+/− dox within one cell line) and include the empty vector line as a control to rule out the effect of doxycycline. Anti-CTLA-4 pre-treatment of the Mec1 cell line concurrently with doxycycline-induction partially rescues the down-modulation of CD80 and subsequently, down-modulation of IL2 in the co-culture system (N=3, IL2 is significantly down-modulated at p<0.05 and is not significantly down-modulated with ipilimumab treatment, p=0.3908) (Fig. 5B). Pre-treatment with anti-CTLA-4 antibody was washed out of culture prior to co-culture with T cells to negate direct effects of CTLA-4 blockade on T cells.

Figure 5. Decreased CD80 reduces IL2 production.

Figure 5.

Open in a new tab

Mec1 Empty Vector or CTLA-4+ cell lines were treated +/− dox for 24h. The Mec1 cells were subsequently co-cultured with anti-CD3/CD28 activated T cells for 48h and supernatant collected. a. Expression of IL2 at 48h co-culture of Mec1+allogeneic T cells, N=3, p=0.0172. b. CD80 modulation with simultaneous treatment +/− 10 μg/mL Ipilimumab during 24h dox-induction of the Mec1 CTLA-4+ cell line. Ipilimumab was washed out 2x prior to 48h co-culture of Mec1 cell lines with anti-CD3/CD28 stimulated allogeneic T cells (N=3, p<0.05 IL2 is significantly decreased with CTLA-4 expression and CD80 down-modulation and is restored with CTLA-4 mediated CD80 restoration, p=0.3908). Supernatant IL2 was measured by Cytokine Bead Array and analyzed by FCAP Array. Data were analyzed using the mixed effect model, incorporating repeated measures for each experiment. Error bars represent mean ± SEM.

Blockade of CTLA-4 on tumor cells functionally affects leukemic progression in vivo

Based on our initial detection of constitutive surface CTLA-4 expression on leukemic cells in the Eμ-TCL1 transgenic model of CLL, we produced a murine model to study whether blockade of tumor expressed CTLA-4 (without blocking T cell CTLA-4) could impact leukemic progression in vivo(24, 25). To isolate the effect of targeting only tumor expressed CTLA-4, we adoptively transferred murine CTLA-4 (mCTLA-4) positive leukemic B-cells into humanized CTLA-4 knock-in mice, which instead expresses human CTLA-4 (hCTLA-4) on its T cells. This permitted the study of tumor expressed CTLA-4 without compromising the effect of T cell expressed CTLA-4. We confirmed that a reported mouse-anti-mCTLA-4 clone, 9d9, versus its isotype control was reactive to mCTLA-4 and lacked cross-reactivity to hCTLA-4 using recombinant protein bound to beads (Fig. S3A). In addition, we acquired a human CTLA-4 knock in mouse (referred to as hCTLA-4) and crossed it with FcRγ-chain knock out mouse (referred to as FcRγ KO) until we reached homozygosity of both genes (Fig. S3B)(26, 39). The FcRγ KO was used to prevent depletion of engrafted cells via known Fc-mediated mechanisms upon blockade with a monoclonal antibody(40). We confirmed that these mice were engraftable with leukemic B cells isolated from the Eμ-TCL1 mouse (data not shown). After screening a series of 5 TCL1 mice, we identified variability in CTLA-4 expression on the TCL1 B cells (Fig. S1). Using an identified mCTLA-4+ TCL1 donor (B4000), we engrafted mCTLA-4+ TCL1 B6 leukemic cells into hCTLA-4+/+mFcRγ−/− B6, immune competent mice (Fig. 6A). At onset of disease (previously defined as ≥20% CD19+CD5+ of CD45+ cells), mice were randomized into two blinded treatment groups receiving either anti-CTLA-4 blocking antibody (9D9) or isotype control (MPC-11) at 100μg doses every 3 days for 5 total injections (Fig. 6B)(28). The amount administered and treatment regimen were based on recent success with this anti-CTLA-4 antibody in a solid tumor model(41). Leukemic progression was assessed by expansion of leukemic cells in the blood, an established measurement for tumor burden in this disease model(25, 28, 42). We measured absolute counts of leukemic CD19+CD5+ cells in the peripheral blood on a weekly basis. We observed that mice treated with anti-CTLA-4 blocking antibody had significantly reduced leukemic burden at day 34, and continued through day 41 post the start of treatment compared to control animals (Fig. 6C; p= 0.03 at day 34 and p=0.006 day41). The difference between blocking tumor expressed CTLA-4 compared to the isotype control on overall survival did not reach statistical significance (Fig. S4; p=0.1442); however, decrease in tumor burden alone suggests CTLA-4 on tumor cells to have a non-negligible effect in understanding response to anti-CTLA-4 therapy.

Figure 6. Blockade of CTLA-4 on tumor cells reduces tumor burden.

Figure 6.

Open in a new tab

a. Expression of surface CTLA-4 on CD45+CD19+CD5+ Live TCL1 splenic cells from mouse#B4000 via flow cytometry b. Experimental design to measure leukemic burden and overall survival in hCTLA-4+/+mFcRγ−/− mice that have received 1e7 mCTLA-4+ TCL1 leukemic cells (B4000). At disease onset (≥20% CD19+/CD5+ of CD45+ cells) mice were treated with 100μg anti-CTLA-4 (9d9) or isotype control (MPC-11) antibodies for 5 total injections on d0, d3, d6, d9, and d12. c. Absolute count of CD19+CD5+ cells in the peripheral blood using Countbright Absolute Count Beads. Data are combined from 2 independent replicate studies (11 mice/group anti-CTLA-4, 12 mice/group isotype control). Leukemic burden was analyzed by the mixed-effect model.

Discussion

It is well established that CTLA-4 is a potent T cell inhibitory protein, but it has not been demonstrated that CTLA-4 must be expressed by T cells to execute negative immune regulation. Our observation that CTLA-4 was in the top 5 most differentially expressed genes by microarray of normal B versus CLL B cells led us to hypothesize that this highly expressed immune regulator could be co-opted to support leukemic progression. Because we found that surface expression of CTLA-4 occurs in the specific context of activated T cells, we further hypothesized that tumor cell CTLA-4 may have an immunosuppressive role directed at T cells. We discovered that similar to Tregs, tumor cell CTLA-4 was able to directly modulate co-stimulatory proteins CD80/CD86. This down-modulation, which consistently favored CD80, resulted in decreased T cell produced IL2 in vitro. In vivo blockade of CTLA-4 on tumor cells (while sparing T cell expressed CTLA-4) reduced leukemic burden in a murine model of CLL. Future studies connecting the immune regulation seen in vitro with the decrease in leukemic burden in vivo by assessing anti-tumor cytotoxicity of T cells from anti-CTLA-4 treated versus control mice will be highly interesting.

With no true signaling signature to date, one of the most well defined and accepted mechanisms of action for CTLA-4 has been its cell-extrinsic role in decreasing co-stimulatory proteins(15, 16, 43). The primary mechanism by which decrease in co-stimulatory proteins, CD80/CD86, is thought to occur is via trans-endocytosis(17). Intriguingly to us, CTLA-4 has been reported numerous times to be expressed on primary tumor cells of multiple cancer types and studied as a potential prognostic factor, but its function on tumor cells has been a relatively untouched subject(8, 18, 19, 44). In CLL, no consensus has been reached regarding the effect of tumor expressed CTLA-4. Reports indicate correlation with progressive disease and contradictorily, negative correlation with CD38 expression, a prognostic factor for aggressive disease(20, 45). However, CLL patients are known to be severely immunocompromised with infections being the leading cause of morbidity and mortality(46). Combined with the observation that matched comparisons of tumor cells in the blood versus the lymph nodes, a site of CLL cell proliferation, shows an increase in CTLA-4 expression, suggests that a potent immune inhibitory protein that is highly expressed in this cancer may have immunosuppressive function. Similar to loss of CD80 or CD86 from the surface of APCs mediated by T cell expressed CTLA-4, we expect that tumor cell expressed CTLA-4 shares this function. Considering the clinical impact of CTLA-4 blockade in multiple cancer types, this finding is highly relevant to understanding the biological mechanism of this treatment. Future studies will need to assess loss of surface co-stimulatory proteins from APCs by tumor cell expressed CTLA-4 in the absence of T cell effects.

We demonstrated in vitro the potential functional role of tumor expressed CTLA-4 to mimic known mechanisms on T cells. To study the potential functional role of leukemic cell CTLA-4 in vivo, we developed a novel murine model. By using a species specific antibody to block mCTLA-4 on adoptively transferred tumor cells and spare human CTLA-4 expressed on host T cells (in the hCTLA-4 knock-in mouse), we observed the functional consequences of tumor CTLA-4. We additionally crossed the hCTLA-4 knock-in mouse to the FcRγ-chain knock out mouse to remove Fc-mediated depletion of our CTLA-4+ engrafted tumor cells. The resulting host mouse (hCTLA-4+/+mFcRγ−/−) can be used to study other engraftable syngeneic tumors in the context of an intact immune system sans phagocytic function.

Using this model, our findings suggest tumor CTLA-4 promotes an increase in leukemic burden rather than pro-apoptotic intrinsic signaling effects on the CTLA-4 expressing cell in CLL as suggested by in vitro work of others(45). While the overall survival was not significantly extended with CTLA-4 blockade, there are multiple factors that should be considered prior to concluding a lack of effect on overall survival. Firstly, CTLA-4 blockade in this model was done using a monoclonal antibody. In CLL, the lymph nodes and bone marrow are notable areas of CLL cell activation and proliferation(47, 48). Potentially incomplete penetration of these sites with anti-CTLA-4 antibody could lead to less potent reduction in leukemic cells than otherwise noted. This idea is circumstantially supported by similarly observed lymphadenopathy in both CTLA-4 and control treated mice in our studies (data not shown). Future studies of tumor CTLA-4 contribution to overall survival may be better studied with complete inhibition of B-cell specific CTLA-4 using in vivo CRISPR/Cas9. Secondly, the relative contribution in these studies of T cell expressed CTLA-4 were not quantified. Anti-CTLA-4 treatment (either globally or T cell specific) has not been tested in the TCL1 murine model of CLL. In this model, it is possible that CTLA-4 blockade does not extend overall survival. Follow up studies looking at the contribution of tumor CTLA-4 versus T cell CTLA-4 using murine or human specific antibodies is achievable in our model and would clarify the currently observed phenotype. Additionally, other tumor types should be assessed that have known effects from CTLA-4 blockade.

Our results imply that non-T-cell expressed CTLA-4 may have a broader role outside of CLL. Not only do other diverse tumor types express CTLA-4 (such as melanoma, carcinoma, and others), but the literature indicates that CTLA-4 is also expressed by normal B cells and at least two studies have peripherally identified CTLA-4 expression in B regulatory cells(7, 9, 18, 19, 49, 50). Because CTLA-4 expression on T cells, and it appears, even more so on non-T cells, is exquisitely regulated, it becomes an extremely difficult task to study the function of this protein on diverse cell types. As our results serve as a prelude to the broader context of CTLA-4 irrespective of cell type, it will become essential to conduct cell specific and anatomical site specific studies of CTLA-4 in vivo. Not just expression, but location and context is important for understanding complex immune regulation as demonstrated in studies of tumor associated lymph nodes(51).

Overall, our findings extend and enhance our understanding of the general biology of CTLA-4 from an immunosuppressive T-cell protein, to an immunosuppressive protein irrespective of cell type (Summarized in Fig. 7). These results provide a critical contribution to a more complete understanding of the CTLA-4 pathway as it applies to immunotherapy.

Figure 7. Summary diagram.

Figure 7.

Open in a new tab

Leukemic B cells (tumor) express intracellular CTLA-4. Co-culture with activated T cells can induce CTLA-4 expression on the cell surface of CLL B cells. CTLA-4 on CLL B cells is then available for down-modulating CD80 (or CD86) from the surface of CD80 and CD86 expressing cells (antigen presenting cells; APC). Insufficient expression of co-stimulatory molecules, CD80 and/or CD86 on APCs can suppress T cells via down-modulation of T cell co-stimulation and ability to produce IL2.

Supplementary Material

1

Acknowledgements

We thank Emilia Mahoney for assistance with confocal microscopy, Virginia Goettl for technical assistance with animal studies, Jeanette Leusen for providing the FcγR KO mouse, and Jason Dubovsky for guidance on the project.

PD was funded by the Graduate Student Pelotonia Fellowship. The work was supported by the NCI P01 CA95426, R35 CA197734, R01 CA159296. Shared resources at the James CCC (Genomics, Biostatistics, and Microscopy) were used and funded by the NCI P30 CA016058.

Footnotes

Disclosures

The authors have declared that no conflict of interest exists

References

  • 1.Brunet JF, Denizot F, Luciani MF, Roux-Dosseto M, Suzan M, Mattei MG, and Golstein P. 1987. A new member of the immunoglobulin superfamily--CTLA-4. Nature 328: 267–270. [DOI] [PubMed] [Google Scholar]
  • 2.Sharpe AH, and Freeman GJ. 2002. The B7-CD28 superfamily. Nat Rev Immunol 2: 116–126. [DOI] [PubMed] [Google Scholar]
  • 3.Egen JG, Kuhns MS, and Allison JP. 2002. CTLA-4: new insights into its biological function and use in tumor immunotherapy. Nat Immunol 3: 611–618. [DOI] [PubMed] [Google Scholar]
  • 4.Hodi FS, O’Day SJ, McDermott DF, Weber RW, Sosman JA, Haanen JB, Gonzalez R, Robert C, Schadendorf D, Hassel JC, Akerley W, van den Eertwegh AJ, Lutzky J, Lorigan P, Vaubel JM, Linette GP, Hogg D, Ottensmeier CH, Lebbé C, Peschel C, Quirt I, Clark JI, Wolchok JD, Weber JS, Tian J, Yellin MJ, Nichol GM, Hoos A, and Urba WJ. 2010. Improved survival with ipilimumab in patients with metastatic melanoma. N Engl J Med 363: 711–723. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Snyder A, Makarov V, Merghoub T, Yuan J, Zaretsky JM, Desrichard A, Walsh LA, Postow MA, Wong P, Ho TS, Hollmann TJ, Bruggeman C, Kannan K, Li Y, Elipenahli C, Liu C, Harbison CT, Wang L, Ribas A, Wolchok JD, and Chan TA. 2014. Genetic basis for clinical response to CTLA-4 blockade in melanoma. N Engl J Med 371: 2189–2199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Kremer JM, Westhovens R, Leon M, Di Giorgio E, Alten R, Steinfeld S, Russell A, Dougados M, Emery P, Nuamah IF, Williams GR, Becker JC, Hagerty DT, and Moreland LW. 2003. Treatment of rheumatoid arthritis by selective inhibition of T-cell activation with fusion protein CTLA4Ig. N Engl J Med 349: 1907–1915. [DOI] [PubMed] [Google Scholar]
  • 7.Kuiper HM, Brouwer M, Linsley PS, and van Lier RA. 1995. Activated T cells can induce high levels of CTLA-4 expression on B cells. J Immunol 155: 1776–1783. [PubMed] [Google Scholar]
  • 8.Pistillo MP, Tazzari PL, Palmisano GL, Pierri I, Bolognesi A, Ferlito F, Capanni P, Polito L, Ratta M, Pileri S, Piccioli M, Basso G, Rissotto L, Conte R, Gobbi M, Stirpe F, and Ferrara GB. 2003. CTLA-4 is not restricted to the lymphoid cell lineage and can function as a target molecule for apoptosis induction of leukemic cells. Blood 101: 202–209. [DOI] [PubMed] [Google Scholar]
  • 9.Quandt D, Hoff H, Rudolph M, Fillatreau S, and Brunner-Weinzierl MC. 2007. A new role of CTLA-4 on B cells in thymus-dependent immune responses in vivo. J Immunol 179: 7316–7324. [DOI] [PubMed] [Google Scholar]
  • 10.Tivol EA, Borriello F, Schweitzer AN, Lynch WP, Bluestone JA, and Sharpe AH. 1995. Loss of CTLA-4 leads to massive lymphoproliferation and fatal multiorgan tissue destruction, revealing a critical negative regulatory role of CTLA-4. Immunity 3: 541–547. [DOI] [PubMed] [Google Scholar]
  • 11.Waterhouse P, Penninger JM, Timms E, Wakeham A, Shahinian A, Lee KP, Thompson CB, Griesser H, and Mak TW. 1995. Lymphoproliferative disorders with early lethality in mice deficient in Ctla-4. Science 270: 985–988. [DOI] [PubMed] [Google Scholar]
  • 12.Wing K, Onishi Y, Prieto-Martin P, Yamaguchi T, Miyara M, Fehervari Z, Nomura T, and Sakaguchi S. 2008. CTLA-4 control over Foxp3+ regulatory T cell function. Science 322: 271–275. [DOI] [PubMed] [Google Scholar]
  • 13.Baecher-Allan C, Brown JA, Freeman GJ, and Hafler DA. 2001. CD4+CD25high regulatory cells in human peripheral blood. J Immunol 167: 1245–1253. [DOI] [PubMed] [Google Scholar]
  • 14.Goldman L, MD; Schafer Andrew I., MD. 2016. Goldman-Cecil Medicine, 25th Edition Elsevier. [Google Scholar]
  • 15.Corse E, and Allison JP. 2012. Cutting edge: CTLA-4 on effector T cells inhibits in trans. J Immunol 189: 1123–1127. [DOI] [PubMed] [Google Scholar]
  • 16.Onishi Y, Fehervari Z, Yamaguchi T, and Sakaguchi S. 2008. Foxp3+ natural regulatory T cells preferentially form aggregates on dendritic cells in vitro and actively inhibit their maturation. Proc Natl Acad Sci U S A 105: 10113–10118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Qureshi OS, Zheng Y, Nakamura K, Attridge K, Manzotti C, Schmidt EM, Baker J, Jeffery LE, Kaur S, Briggs Z, Hou TZ, Futter CE, Anderson G, Walker LS, and Sansom DM. 2011. Trans-endocytosis of CD80 and CD86: a molecular basis for the cell-extrinsic function of CTLA-4. Science 332: 600–603. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Huang PY, Guo SS, Zhang Y, Lu JB, Chen QY, Tang LQ, Zhang L, Liu LT, and Mai HQ. 2016. Tumor CTLA-4 overexpression predicts poor survival in patients with nasopharyngeal carcinoma. Oncotarget 7: 13060–13068. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Zhang XF, Pan K, Weng DS, Chen CL, Wang QJ, Zhao JJ, Pan QZ, Liu Q, Jiang SS, Li YQ, Zhang HX, and Xia JC. 2016. Cytotoxic T lymphocyte antigen-4 expression in esophageal carcinoma: implications for prognosis. Oncotarget 7: 26670–26679. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Kosmaczewska A, Ciszak L, Suwalska K, Wolowiec D, and Frydecka I. 2005. CTLA-4 overexpression in CD19+/CD5+ cells correlates with the level of cell cycle regulators and disease progression in B-CLL patients. Leukemia 19: 301–304. [DOI] [PubMed] [Google Scholar]
  • 21.Herishanu Y, Pérez-Galán P, Liu D, Biancotto A, Pittaluga S, Vire B, Gibellini F, Njuguna N, Lee E, Stennett L, Raghavachari N, Liu P, McCoy JP, Raffeld M, Stetler-Stevenson M, Yuan C, Sherry R, Arthur DC, Maric I, White T, Marti GE, Munson P, Wilson WH, and Wiestner A. 2011. The lymph node microenvironment promotes B-cell receptor signaling, NF-kappaB activation, and tumor proliferation in chronic lymphocytic leukemia. Blood 117: 563–574. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Hertlein E, Beckwith KA, Lozanski G, Chen TL, Towns WH, Johnson AJ, Lehman A, Ruppert AS, Bolon B, Andritsos L, Lozanski A, Rassenti L, Zhao W, Jarvinen TM, Senter L, Croce CM, Symer DE, de la Chapelle A, Heerema NA, and Byrd JC. 2013. Characterization of a new chronic lymphocytic leukemia cell line for mechanistic in vitro and in vivo studies relevant to disease. PLoS One 8: e76607. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Stacchini A, Aragno M, Vallario A, Alfarano A, Circosta P, Gottardi D, Faldella A, Rege-Cambrin G, Thunberg U, Nilsson K, and Caligaris-Cappio F. 1999. MEC1 and MEC2: two new cell lines derived from B-chronic lymphocytic leukaemia in prolymphocytoid transformation. Leuk Res 23: 127–136. [DOI] [PubMed] [Google Scholar]
  • 24.Gorgun G, Ramsay AG, Holderried TA, Zahrieh D, Le Dieu R, Liu F, Quackenbush J, Croce CM, and Gribben JG. 2009. E(mu)-TCL1 mice represent a model for immunotherapeutic reversal of chronic lymphocytic leukemia-induced T-cell dysfunction. Proc Natl Acad Sci U S A 106: 6250–6255. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Johnson AJ, Lucas DM, Muthusamy N, Smith LL, Edwards RB, De Lay MD, Croce CM, Grever MR, and Byrd JC. 2006. Characterization of the TCL-1 transgenic mouse as a preclinical drug development tool for human chronic lymphocytic leukemia. Blood 108: 1334–1338. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Lute KD, May KF, Lu P, Zhang H, Kocak E, Mosinger B, Wolford C, Phillips G, Caligiuri MA, Zheng P, and Liu Y. 2005. Human CTLA4 knock-in mice unravel the quantitative link between tumor immunity and autoimmunity induced by anti-CTLA-4 antibodies. Blood 106: 3127–3133. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.de Haij S, Jansen JH, Boross P, Beurskens FJ, Bakema JE, Bos DL, Martens A, Verbeek JS, Parren PW, van de Winkel JG, and Leusen JH. 2010. In vivo cytotoxicity of type I CD20 antibodies critically depends on Fc receptor ITAM signaling. Cancer Res 70: 3209–3217. [DOI] [PubMed] [Google Scholar]
  • 28.Beckwith KA, Frissora FW, Stefanovski MR, Towns WH, Cheney C, Mo X, Deckert J, Croce CM, Flynn JM, Andritsos LA, Jones JA, Maddocks KJ, Lozanski G, Byrd JC, and Muthusamy N. 2014. The CD37-targeted antibody-drug conjugate IMGN529 is highly active against human CLL and in a novel CD37 transgenic murine leukemia model. Leukemia 28: 1501–1510. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Chen TL, Gupta N, Lehman A, Ruppert AS, Yu L, Oakes CC, Claus R, Plass C, Maddocks KJ, Andritsos L, Jones JA, Lucas DM, Johnson AJ, Byrd JC, and Hertlein E. 2016. Hsp90 inhibition increases SOCS3 transcript and regulates migration and cell death in chronic lymphocytic leukemia. Oncotarget 7: 28684–28696. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Schmittgen TD, and Livak KJ. 2008. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 3: 1101–1108. [DOI] [PubMed] [Google Scholar]
  • 31.Freeman GJ, Lombard DB, Gimmi CD, Brod SA, Lee K, Laning JC, Hafler DA, Dorf ME, Gray GS, Reiser H, and et al. 1992. CTLA-4 and CD28 mRNA are coexpressed in most T cells after activation. Expression of CTLA-4 and CD28 mRNA does not correlate with the pattern of lymphokine production. J Immunol 149: 3795–3801. [PubMed] [Google Scholar]
  • 32.Lindsten T, Lee KP, Harris ES, Petryniak B, Craighead N, Reynolds PJ, Lombard DB, Freeman GJ, Nadler LM, Gray GS, and et al. 1993. Characterization of CTLA-4 structure and expression on human T cells. J Immunol 151: 3489–3499. [PubMed] [Google Scholar]
  • 33.Nganga VK, Palmer VL, Naushad H, Kassmeier MD, Anderson DK, Perry GA, Schabla NM, and Swanson PC. 2013. Accelerated progression of chronic lymphocytic leukemia in Emu-TCL1 mice expressing catalytically inactive RAG1. Blood 121: 3855–3866, S3851-3816. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Maszyna F, Hoff H, Kunkel D, Radbruch A, and Brunner-Weinzierl MC. 2003. Diversity of clonal T cell proliferation is mediated by differential expression of CD152 (CTLA-4) on the cell surface of activated individual T lymphocytes. J Immunol 171: 3459–3466. [DOI] [PubMed] [Google Scholar]
  • 35.Zhang Y, and Allison JP. 1997. Interaction of CTLA-4 with AP50, a clathrin-coated pit adaptor protein. Proc Natl Acad Sci U S A 94: 9273–9278. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Shiratori T, Miyatake S, Ohno H, Nakaseko C, Isono K, Bonifacino JS, and Saito T. 1997. Tyrosine phosphorylation controls internalization of CTLA-4 by regulating its interaction with clathrin-associated adaptor complex AP-2. Immunity 6: 583–589. [DOI] [PubMed] [Google Scholar]
  • 37.Chuang E, Alegre ML, Duckett CS, Noel PJ, Vander Heiden MG, and Thompson CB. 1997. Interaction of CTLA-4 with the clathrin-associated protein AP50 results in ligand-independent endocytosis that limits cell surface expression. J Immunol 159: 144–151. [PubMed] [Google Scholar]
  • 38.Bradshaw JD, Lu P, Leytze G, Rodgers J, Schieven GL, Bennett KL, Linsley PS, and Kurtz SE. 1997. Interaction of the cytoplasmic tail of CTLA-4 (CD152) with a clathrin-associated protein is negatively regulated by tyrosine phosphorylation. Biochemistry 36: 15975–15982. [DOI] [PubMed] [Google Scholar]
  • 39.Takai T, Li M, Sylvestre D, Clynes R, and Ravetch JV. 1994. FcR gamma chain deletion results in pleiotrophic effector cell defects. Cell 76: 519–529. [DOI] [PubMed] [Google Scholar]
  • 40.Simpson TR, Li F, Montalvo-Ortiz W, Sepulveda MA, Bergerhoff K, Arce F, Roddie C, Henry JY, Yagita H, Wolchok JD, Peggs KS, Ravetch JV, Allison JP, and Quezada SA. 2013. Fc-dependent depletion of tumor-infiltrating regulatory T cells co-defines the efficacy of anti-CTLA-4 therapy against melanoma. J Exp Med 210: 1695–1710. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Vetizou M, Pitt JM, Daillere R, Lepage P, Waldschmitt N, Flament C, Rusakiewicz S, Routy B, Roberti MP, Duong CP, Poirier-Colame V, Roux A, Becharef S, Formenti S, Golden E, Cording S, Eberl G, Schlitzer A, Ginhoux F, Mani S, Yamazaki T, Jacquelot N, Enot DP, Berard M, Nigou J, Opolon P, Eggermont A, Woerther PL, Chachaty E, Chaput N, Robert C, Mateus C, Kroemer G, Raoult D, Boneca IG, Carbonnel F, Chamaillard M, and Zitvogel L. 2015. Anticancer immunotherapy by CTLA-4 blockade relies on the gut microbiota. Science 350: 1079–1084. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Woyach JA, Bojnik E, Ruppert AS, Stefanovski MR, Goettl VM, Smucker KA, Smith LL, Dubovsky JA, Towns WH, MacMurray J, Harrington BK, Davis ME, Gobessi S, Laurenti L, Chang BY, Buggy JJ, Efremov DG, Byrd JC, and Johnson AJ. 2014. Bruton’s tyrosine kinase (BTK) function is important to the development and expansion of chronic lymphocytic leukemia (CLL). Blood 123: 1207–1213. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Oderup C, Cederbom L, Makowska A, Cilio CM, and Ivars F. 2006. Cytotoxic T lymphocyte antigen-4-dependent down-modulation of costimulatory molecules on dendritic cells in CD4+ CD25+ regulatory T-cell-mediated suppression. Immunology 118: 240–249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Laurent S, Queirolo P, Boero S, Salvi S, Piccioli P, Boccardo S, Minghelli S, Morabito A, Fontana V, Pietra G, Carrega P, Ferrari N, Tosetti F, Chang LJ, Mingari MC, Ferlazzo G, Poggi A, and Pistillo MP. 2013. The engagement of CTLA-4 on primary melanoma cell lines induces antibody-dependent cellular cytotoxicity and TNF-alpha production. J Transl Med 11: 108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Mittal AK, Chaturvedi NK, Rohlfsen RA, Gupta P, Joshi AD, Hegde GV, Bociek RG, and Joshi SS. 2013. Role of CTLA4 in the proliferation and survival of chronic lymphocytic leukemia. PLoS One 8: e70352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Tsiodras S, Samonis G, Keating MJ, and Kontoyiannis DP. 2000. Infection and immunity in chronic lymphocytic leukemia. Mayo Clin Proc 75: 1039–1054. [DOI] [PubMed] [Google Scholar]
  • 47.Granziero L, Ghia P, Circosta P, Gottardi D, Strola G, Geuna M, Montagna L, Piccoli P, Chilosi M, and Caligaris-Cappio F. 2001. Survivin is expressed on CD40 stimulation and interfaces proliferation and apoptosis in B-cell chronic lymphocytic leukemia. Blood 97: 2777–2783. [DOI] [PubMed] [Google Scholar]
  • 48.Messmer BT, Messmer D, Allen SL, Kolitz JE, Kudalkar P, Cesar D, Murphy EJ, Koduru P, Ferrarini M, Zupo S, Cutrona G, Damle RN, Wasil T, Rai KR, Hellerstein MK, and Chiorazzi N. 2005. In vivo measurements document the dynamic cellular kinetics of chronic lymphocytic leukemia B cells. J Clin Invest 115: 755–764. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Xiao X, Lao XM, Chen MM, Liu RX, Wei Y, Ouyang FZ, Chen DP, Zhao XY, Zhao Q, Li XF, Liu CL, Zheng L, and Kuang DM. 2016. PD-1hi Identifies a Novel Regulatory B-cell Population in Human Hepatoma That Promotes Disease Progression. Cancer Discov 6: 546–559. [DOI] [PubMed] [Google Scholar]
  • 50.Yang YQ, Yang W, Yao Y, Ma HD, Wang YH, Li L, Wu Q, Gershwin ME, and Lian ZX. 2016. Dysregulation of peritoneal cavity B1a cells and murine primary biliary cholangitis. Oncotarget 7: 26992–27006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Joshi NS, Akama-Garren EH, Lu Y, Lee DY, Chang GP, Li A, DuPage M, Tammela T, Kerper NR, Farago AF, Robbins R, Crowley DM, Bronson RT, and Jacks T. 2015. Regulatory T Cells in Tumor-Associated Tertiary Lymphoid Structures Suppress Anti-tumor T Cell Responses. Immunity 43: 579–590. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS1522618-supplement-1.pdf (609.1KB, pdf)

RESOURCES