Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Sense and antisense primers used
| Name of primer | Primer sequence (5′–3′) | Product size (bp) for C2-ACEF | Product size (bp) for C2-ACDF |
|---|---|---|---|
| 231s | gatagggaccttctgcatgg | 454 | 454 |
| 1494as | gaagacgacctgctcattcc | ||
| 1478s | atgagcaggtcgtcttcac | 1142 | 1142 |
| 2720 as | ggcataggcgatacgtttgt | ||
| 1478s | atgagcaggtcgtcttcac | 1146 | |
| 4563as | gatgtcggtcttgcctaact | ||
| 1478s | atgagcaggtcgtcttcac | 1341 | |
| 2919as | ggcttgcttcttggtgtag |
