A synthetic formulation, Dhanwantharam kashaya, delays senescence in stem cells

Abstract

Objectives

Mesenchymal stem cells (MSCs) derived from post‐natal tissues offer a suitable source of MSCs for cellular therapy. Limitation of the use of MSCs for therapeutic purposes is attributed to the onset of senescence and slowing down of proliferation upon repeated passaging. Dhanwantram kashaya (DK), a synthetic herbal formulation, is widely used in Ayurvedic medicine as a growth stimulant in children and for nerve regeneration. In this study, we evaluated the effects of DK on the proliferation, viability and senescence of human Wharton jelly MSCs (WJMSCs) in vitro.

Results

Using the MTT proliferation assay and live/dead trypan blue analysis, we found that DK increased proliferation of WJMSC_S up to three folds when supplemented in the culture media. The BrdU cell proliferation assay showed a substantial increase in WJMSCs treated with DK. Notably, the β‐galactosidase senescence assay revealed that drug treated WJMSCs at late passage still had intact and viable WJMSCs whereas the untreated cells exhibited profound senescence.

Conclusion

These studies indicate that DK enhances the quality of WJMSCs by not only increasing the proliferation rate and decreasing their turnover time but also by delaying senescence. We have, thus, identified for the first time that a traditional Ayurvedic formulation, Dhanwantram kashaya, used as a growth enhancer, is able to improve the yield and quality of stem cells in vitro and could be an effective non‐toxic supplement for culturing WJMSCs for clinical applications.

Introduction

Multipotential properties of mesenchymal stem cells (MSCs) have been the subject of great interest among researchers for a number of years, to investigate their possible development in clinical applications, particularly for stem cell therapy, regenerative medicine and tissue engineering. The umbilical cord is one of the richest sources of foetus‐derived stem cells with inherent properties such as multi‐differentiation potential, immunomodulatory potency and self‐renewal 1. However on the grand scale, their frequency is low, necessitating their expansion in vitro prior to possible clinical use, the major challenge being generation of sufficiently large quantities of homogenous, healthy and viable MSCs. A further caveat is that MSCs, from the moment of in vitro culturing, also almost undetectably, enter senescence 2.

Herbal medicines, medicinal products of leaves, bark, seeds, fruits or flowers and roots of plants, have been used since ancient times to promote health. The Indian system of traditional medicine, Ayurveda, is believed to help restore body balance, and to maintain and regenerates cells damaged during the ageing process 3. Dhanwantharam kashaya (DK) is used widely in Ayurvedic medicine for enhancement of growth in children, for nerve regeneration, to improve memory, to cause post‐partum restoration and to treat neuralgia. It is available commercially and contains a combination of more than 20 herbs 4, 5.

As DK has been used mainly in regeneration‐related disorders, we have studied any ability it might have to improve quality of stem cells, which compose the original cell source from which regeneration and restoration of tissue begin. Here, the in vitro study has suggested that DK contains active constituents that were able to stimulate proliferation of human Wharton's jelly‐derived MSCs (WJMSCs), reduce their senescence indicators and enhance their quality, thereby improving their yield essential before clinical use.

Material and methods

Isolation and culture of human umbilical cord‐derived mesenchymal stem cells

Human umbilical cords, with approval of our Institutional Review Board and according to regulations of the Research Ethics Committee of Manipal Hospital, were obtained with informed consent, from healthy mothers who underwent uncomplicated normal deliveries. Mesenchymal stem cells were isolated from Wharton's jelly of the cord using previously reported protocols 6, 7, 8, with some modifications. Collected cords were cleaned by washing thoroughly in Dulbecco's phosphate‐buffered saline (DPBS) containing 1% antibiotic‐antimycotic, were minced into fragments of around 2 cm in length, and were centrifuged at 250× g for 5 min. Following removal of the supernatant fraction, tissue was washed with serum‐free Dulbecco's modified Eagle's medium (DMEM) (Gibco‐Invitrogen, USA) and centrifuged at 250× g for 5 min. Samples were then incubated at 37 °C for 18 h in DMEM basal medium containing collagenase (500 μg/ml), then washed and strained using a cell strainer (BD Bioscience, San Jose, CA, USA). Dissociated cells were further dispersed by treatment with 10% FBS‐DMEM and were counted. Cells were then plated, characterized and expanded through several passages, as indicated. Standard culture medium used was DMEM supplemented with 10% foetal bovine serum, 2 mm glutamax and 1% antibiotic‐antimycotic (all from Gibco).

Characterization of cultured WJMSC

Flow cytometric analysis

Cells from early passages (P3–P4) were used for characterization studies. Cell suspension was centrifuged at 200 g for 10 min and washed twice in PBS. They were then fixed in pre‐chilled 70% ethanol and incubated in mouse anti‐human fluorescein isothiocyanate (FITC) antibodies against MSC‐positive markers CD73, CD90, CD166 and negative marker CD34 (1:100 dilution) (all antibodies were purchased from Becton Dickenson, San Diego, CA, USA), for 1 h on ice. Cells were acquired using BD‐FACS Calibur flow cytometer with 488 nm laser, and data were analysed using Cell Quest Software (Becton Dickinson, San Jose, CA, USA).

Molecular analysis

Total RNA from passage 4 WJMSCs was isolated by adding 0.5 ml of TRI reagent according to the manufacturer's instructions (Sigma‐Aldrich, St. Louis, MO, USA). Reverse transcription reactions were performed in 20 μl volume with 1–5 μg total RNA, using M‐MLV‐reverse transcriptase cDNA synthesis kit (Ambion, TX, USA), according to the manufacturer's protocol. Using cDNA, expression of mRNA related to stemness and pluripotency (Table 1) were investigated, using glyceraldehyde‐3‐ phosphate dehydrogenase (GAPDH) as positive control. Amplification of specific primers from the cDNA was carried out by using RT‐PCR master mix containing 10× PCR buffers, 10 mm dNTP mix, 25 mm MgCl₂, Taq DNA polymerase, DEPC–water and respective primers (all obtained from Sigma‐Aldrich).

Table 1.

Primers used for RT‐PCR

Primer	Sequence (5′–3′)	T m (°C)	Productsize (bp)
Ki67	F: CTTTGGGTGCGACTTGACG R: GTCGACCCCGCTCCTTTT	62	199
Oct4	F: AGGGCAAGCGATCAAGCA R: GGAAAGGGACCGAGGAGTA	57	168
Nanog	F: CCTCCTCCATGGATCTGCTTATTCA R: CAGGTCTTCACCTGTTTGTAGCTGAG	45	262
Rex1	F: GAAGAGGCCTTCACTCTAGTAGTG R: TTTCTGGTGTCTTGTCTTTGCCCG	57	179
Klf4	F: GGCGAGAAACCTTACCACTGT R: TACTGAACTCTCTCTCCTGGCA	55	370
SSEA3	F: CCCTGAACCAGTTCGATGTT R: CATTGCTTGAAGCCAGTTGA	51	197
VIMENTIN	F: ATCTGTGCTACAGCACTCACTT R: CCACCCTCAGGTCTTTCCTC	59	207
SEA4	F: TGGACGGGCACAACTTCATC R: GGGCAGGTTCTTGGCACTCT	57	119
p21	F: GAGGCCGGGATGAGTTGGGAGGAG R: CAGCCGGCGTTTGGAGTGGTAGAA	62	220
Cyclin D1	F: AACTACCTGGACCGCTTCCT R: CCACTTGAGCTTGTTCACCA	62	165
CD 90	F: CCCCAATCCCTCAAACCT R: CATCCCACTACCCCTCACAT	60	266

Proliferation and population doubling studies of WJMSC with DK

Dhanwantharam kashaya was obtained commercially from Kottakkal Arya Vaidya Sala, Bangalore, India. WJMSCs were plated at 1500 cells/well in 96‐well plates for 12 h; after they had attached, they were treated with medium only or with media containing DK at a range of concentrations 5, 7.5, 10, 20, 40 and 50 μg/ml. Cells were then incubated for 24 h, all experiments being performed in triplicate. After 24 h, culture medium was removed and 10 μl of 3‐(4, 5‐dimethylthiazol‐2‐yl)‐2, 5‐diphenyltetrazolium bromide (MTT) solution (TACS MTT assay kit, MD, USA) was added and assayed according to the manufacturer's instructions. Optical density of solutions in wells was measured at 560 nm using a photometer (Victor 3 Multilabel Plate Reader, Perkin‐Elmer, MA, USA). Concentration of DK exhibiting highest level of cell proliferation (10 μg/ml) was used for further experiments. A population doubling assay was performed by incubating cells in 10 μg/ml DK over a range of time periods, 12, 24 and 48 h, and by determining proliferation rate by MTT assay. Experiments were repeated using non‐stem type cells, mouse embryonic fibroblasts (MEF), as control using 10 μg/ml of DK for 24 h; proliferation level was determined using MTT assay with and without drug treatment.

Cell viability measured using the trypan blue exclusion assay

The WJMSCs were plated at 1500 cells/ml and after attachment, were treated with medium only or with media containing DK, and were incubated for 24 h. After trypsinizing, 100 μl cell suspension of each condition was treated separately with 100 μl of 0.4% trypan blue. Using bright field optics, numbers of stained cells with intact plasmamembranes were determined.

Immunocytochemistry

Cells were plated at 1500 cell/ml into four chambered slides with or without DK. After treatment for 24 h, cells were fixed in 4% paraformaldehyde (Sigma, MO, USA) for 20 min, and permeabilized with 0.5% Triton‐X‐100. Then, they were blocked with blocking buffer for 30 min and treated with primary non‐labelled mouse anti‐human anti‐vimentin (1:250 dilutions; BD Biosciences) for 3 h. After being washed, they were incubated with FITC‐labelled anti‐mouse secondary antibodies (1:500 dilutions; Invitrogen, USA) for 1 h at 37 °C. Nuclear stain 4′,6‐diamidoino‐2‐ phenylindole (DAPI) (1:10 000 dilutions) was used for nuclear visualization and a drop of antifade reagent (Vectashield; Vector Laboratory, Burlingame, CA, USA) was added to avoid quenching of the fluorochrome before coverslip sealing. For determination of membrane permeability and nuclear staining with propidium iodide (PI), the permeabilization step with Triton X100 was omitted. Two hundred microlitres of PI (2.5 μm) was added, incubated for 30 min at 37 °C and antifade reagent was added, before visualization. Slides were viewed using a Nikon Eclipse TE2000‐U fluorescence microscope and micrographs were taken using Qimaging‐ QICAM‐fast 1394.

Cells subjected to drug treatment were also analysed for expression of MSC markers CD73 and CD90, after flow cytometry, as mentioned previously.

Bromodeoxyuridine (BrdU) cell proliferation assay

Cell proliferation was assessed by bromouridine incorporation using a BrdU cell proliferation kit (Cell Signaling Technology, MA, USA) in accordance with the manufacturer's instructions. WJMSCs were plated in triplicate at 8000 cell/well in 96‐well plates either with or without medium containing DK, along with BrdU solution (10 μm). BrdU was incorporated during DNA replication and cells were fixed and incubated with horseradish peroxidase (HRP)‐linked BrdU antibody as per manufacturer's instructions. Cell proliferation was quantified using tetramethylbenzidine (TMB) substrate specific to HRP and optical density of the blue final reaction product was measured at 450 nm using a photometer (Victor 3 Multilabel Plate Reader, MA, USA). Whole experiments were performed in triplicate.

Determination of cell senescence

Passage 12 WJMSCs were used to compare levels of senescence of untreated and drug‐treated cells, having been treated with the drug from passage 9 onwards. Senescence was determined using a senescence‐associated β‐galactosidase staining kit (Cell Signaling Technology). Once cells reached 80–90% confluence, plates were fixed in fixative solution and incubated with β‐galactosidase solution at 37 °C overnight in a dry incubator. Plates were checked for development of blue colouration with bright field phase contrast microscopy (Nikon‐ Eclipse TE 2000‐S) and micrographs were taken using Qimaging‐ QICAM‐fast 1394.

Senescence was further determined by analysing expression of senescence and proliferation markers (Table 1) by RT‐PCR as mentioned previously.

Statistical analysis

Statistical analyses were performed using SPSS software version 16. Two‐sided Student's t‐test was used to determine significance of any differences. Proliferation was found to be significantly different between DK‐treated cells and untreated cells. Similarly, population doubling time and BrdU studies indicated that proliferation was significantly higher in DK‐treated WJMSCs compared to untreated cells (P < 0.05).

Results

Characterization of WJMSCs

Mesenchymal stem cells were isolated from Wharton's jelly (WJMSCs), confluent cultures were established and were cultured through a number of passages (Fig. 1a). Cells were characterized for percentage expression of MSC‐specific positive markers CD73 (91.68%), CD90 (96%), CD166 (55.48%) and MSC negative marker CD34 (0.68%), by flow cytometry (Fig. 1b). Further, to confirm stemness and pluripotency, we investigated presence of pluripotent markers such as Rex‐1, Nanog, vimentin, SSEA‐3 and 4 and Klf, by RT‐PCR (Fig. 1c). Thus, isolated and expanded cells were confirmed to be a homogenous population of MSCs before subjection to treatment with the drug, DK.

Figure 1.

Wharton's jelly MSC ( WJMSC ) culture and its characterization by flow cytometry and RT‐PCR. (a) Mesenchymal stem cells isolated from Wharton jelly and cultured in media containing 10% FBS. (b) Characterization by flow cytometry showing positive population for CD90, CD73, CD166 and negative for CD34. (c) WJ‐MSCs are characterized by RT‐PCR showing the expression of rex‐1, oct4, Klf, ssea‐4, ssea‐3 and nanog.

Effect of DK on expansion of WJMSCs

MTT assay had been used to investigate rates of cell proliferation at different drug dilutions. We observed that DK significantly enhanced proliferation of cells in a dose‐dependent manner, and maximum effect was produced at 10 μg/ml (Fig. 2a) and this concentration was used for all subsequent experiments with the drug. Population doubling studied over a period of 12, 24 and 48 h, with initial seeding density of 500 cells/well, had in the order of 50% increase in proliferation at all time points in drug‐treated WJMSCs when compared with to controls (Fig. 2b). Enhanced proliferation was not observed in non‐stem cell controls, MEF, were used (Fig. 2c). Comparison of drug‐treated and untreated WJMSCs displayed differences in phenotypic appearance and proliferative properties, with clear differences in their morphology, cell size and cell density, typically with clusters of cells forming colonies and showing greater cell‐to‐cell contact (Fig. 2d and 2e). Furthermore, it was noted that DK treatment caused retention of MSC characteristics of the cells, as determined by flow cytometry (Fig. 2f). Expression of MSC markers CD73 and CD90 by drug‐treated MSCs was similar to native untreated MSCs. Similarly, RT‐PCR of CD90 showed similar mRNA expression levels in both untreated and drug‐treated WJMSCs (Fig 2g).

Figure 2.

Increased proliferation of drug‐treated Wharton's jelly MSC ( WJMSC ), flow cytometric and RT‐PCR analysis of drug‐treated WJMSC. (a) WJMSCs were cultured with drug‐supplemented media of various concentrations and an MTT assay was performed after 24 h. Drug treatment increased the cell proliferation of WJMSCs and the concentration of 10 μg/ml had a maximum effect. Data represent the cell proliferation of various concentrations which is taken as a mean value of the triplicates (n = 3, *P < 0.05). (b) Population doubling analysis showed approximately 50% increase in cell population at 12, 24 and 48 h. (c) Drug had no effect on the proliferation of mouse embryonic fibroblasts (MEF) when incubated with Dhanwantharam kashaya at 10 μg/ml for 24 h. (d) WJMSCs cultured without drug (48 h). (e) WJMSCs cultured with drug (48 h). (f) Mesenchymal stem cells (MSC) markers CD73 and CD90 remained the same in drug‐treated MSC determined by flow cytometry and (g) RT‐PCR for CD90.

Analysis of viability and integrity of drug‐treated WJMSCs

Using initial seeding density of 1500 cells, we analysed changes in membrane permeability by staining with trypan blue, and observed that percentages of viable cells were in the order of 2‐fold higher and percentages of dead cells were approximately 3‐fold lower (Fig. 3a and 3b) of DK‐treated cells compared to untreated ones. In agreement with this, BrdU cell proliferation assay revealed higher incorporation of BrdU in drug‐treated MSCs, indicating higher proliferative capacity (Fig. 3c).

Figure 3.

Live–dead assay and BrdU proliferation study. The number of intact and dead cells was determined manually in drug‐treated (1:100, 12 h) and untreated cells by staining the cells with trypan blue. The graph indicates a significant increase in live cells (a) and conversely a significant decrease of dead cells (b) in the drug‐treated cells when compared to the control. (c) BrdU cell proliferation assay also revealed higher incorporation of BrdU in the drug‐treated mesenchymal stem cells compared to untreated indicating a higher proliferative capacity (n = 3, *P value <0.05).

Propidium iodide is membrane‐impermeable and is generally excluded from viable cells; it is commonly used for identifying dead cells in a population. PI staining showed that percentages of viable cells were higher in treated groups compared to untreated cells (Fig. 4a and 4b). We further investigated whether the drug had any impact on integrity of cells by immunostaining for vimentin, an intermediate filament protein. DK‐treated cells demonstrated clearer and more distinct vimentin staining when compared to controls (Fig. 4 c and 4d). Hence, the data support the notion that DK also facilitates maintenance of overall cell shape and structure.

Figure 4.

Propidium iodide ( PI ) staining to study cell membrane permeabilization and cytoskeletal staining with vimentin. After incubating equal number of Wharton's jelly MSCs (WJMSCs) (1500 cells/ml) with Dhanwantharam kashaya (DK) and without DK for 24 h, PI staining and immunohistochemistry for vimentin were performed. Drug‐treated WJMSCs showed lesser uptake and staining of PI (b) when compared to the untreated WJMSCs (a) at passage 6 thereby showing better membrane integrity of the drug‐treated cells thereby showing better membrane integrity of the drug‐treated cells. Cytoskeletal marker staining for vimentin was more prominent and clear in drug‐treated WJMSCs (d) than in untreated cells (c) demonstrating cytoskeletal integrity of the drug‐treated cells.

Role of DK in cell senescence

As MSCs have been reported to have a limited life span, any effect of DK on senescence of WJMSCs was evaluated using senescence‐associated β‐galactosidase cell‐staining. It was clearly observed that DK‐treated cells had little or no cells positive for the β‐galactosidase staining (Fig. 5b), whereas untreated cells demonstrated pronounced blue staining, indicating senescence‐associated β‐galactosidase activity (Fig. 5a).

Figure 5.

Effect of drug on cell senescence–β‐galactosidase senescence assay. β‐Galactosidase staining indicating senescing Wharton's jelly MSCs WJMSCs was observed more in untreated cells (a), the arrows indicating blue stain and presence of β‐galactosidase than in drug‐treated WJMSCs (b) indicating that drug treatment delayed senescence in these cells. (c) RT‐PCR indicated that senescence‐associated markers p21 and CycD1 was downregulated in Dhanwantharam kashaya (DK)‐treated WJMSCs. Proliferation marker ki67 was high in DK‐treated WJMSCs.

Presence of senescence marker p21, cyclin D1, and proliferation marker Ki‐67 were analysed for mRNA expression using RT‐ PCR and it was seen that p21 and cyclin D1 were drastically lower in the DK‐treated cells, whereas proliferation marker Ki‐67 was higher (Fig. 5c). Loss of expression of p21 clearly indicates that senescence of MSCs was delayed by DK treatment.

Discussion

Wharton's jelly‐derived MSCs compose a primitive stromal cell population, are highly proliferative, tolerate freeze‐thaw conditions and propagate further until their proliferative activity begins to decline 9, 10. However, one of the major challenges of regenerative medicine for clinical applications is generation of large quantities of good quality, well characterized stem cells 11. Our main investigation was to study whether the Ayurvedic medicine, Dhanwantram kashaya, had any effect on WJMSCs. Plant extracts from various sources have been studied in the context of stem cells 12 for enhancing proliferation 13, differentiation into osteogenic 14, 15 and neuronal lineages 16 and neural stem cells 17, 18. Therapeutic compounds derived from Ayurvedic medicine have been identified to suppress both inflammation and cancer 19. In this study, we established that DK enhanced proliferation of WJMSCs without compromising their stemness, thus the study is significant as it is the first time that an Ayurvedic drug was observed to have a profound effect on stem cells.

Dhanwantram kashaya is a versatile product, of in the order of forty ingredients. It is habitually indicated for use in anomalies of pregnancy and is effective for treatment of diseases affecting many connective tissues such as the bone, joints, ligaments and muscles and of the nervous system. It is also effective for traumatic conditions of bone, for arthritis and vital points; it is traditionally used in paediatric diseases and for post partum care 20. This formulation has been exceptionally effective clinically in conditions subsequent to trauma or for degenerative conditions following trauma; this suggests that it might have a role in tissue regeneration, probably by activating tissue stem cells. Rasayana used in Ayurveda medicine has a protective and adaptogenic effect 21 and further natural compounds used in Ayurveda have been used in for treatment of cerebral ischaemia/reperfusion injury 22. Here we were able to demonstrate DK's effects on stem cells in vitro where it showed marked enhancement of proliferative activity, facilitated cell viability and maintained cell integrity during long‐term expansion of WJMSCs. Maintenance of cytoskeletal structure suggests that DK‐treated MSCs had organized growth and architectural integrity. A notable observation was that the drug treatment caused retention of expression of stemness markers of MSCs, CD73 and CD90, indicating that their phenotype remained unchanged. Significantly, DK treatment did not have any effect on non‐stem cells, MEFs used as controls, suggesting that the drug enhanced growth by mobilizing only the stem cell population. This might be an indication that this drug, used for centuries in traditional Indian medicine, may be acting by specifically mobilizing and enhancing the stem cell pool, thereby promoting regeneration.

As enhanced effect on cell proliferation was observed, we wanted to explore whether DK could retard WJMSC senescence. Replicative senescence of MSCs isolated in vitro is a continuous process starting from time of their isolation from tissue and it has a wide‐ranging effects from alterations in differentiation potential to changes in global gene expression pattern. First, we confirmed that DK reduced senescence of the cells by staining for senescence‐associated ß‐galactosidase, which was seen in the DK‐treated cohort. On the basis of these results, we explored expression patterns of markers p21 and cyclin D1, associated with onset and maintenance of cell senescence 23, 24 and found that they were clearly downregulated. Cell senescence is primarily induced through the p53/p21 pathway and activated Wnt/ß catenin signalling promotes senescence of MSCs as demonstrated in a recent study using serum from aged rats to induce it 25. Further mechanistic study into downstream activators of p21 and Wnt/ß catenin modulation in DK‐treated cells would be needed to elucidate molecular pathways affected by DK.

One area in which regenerative medicine is heading is in the use of drugs to modulate both quality and yield of stem cells following their removal from their niche in tissue. This study reports for the first time the effect of an Ayurvedic drug on improving the quality of mesenchymal stem cells in vitro. Further, with respect to aging of stem cells in culture (a major impediment to successful use of MSCs for therapeutic purposes), we demonstrated in this study that the synthetic Ayurvedic drug, DK, was able to significantly reduce ageing and senescence of MSCs. Further studies such as in vitro mutagenesis testing and in vivo studies with DK are required for determining safety of the drug for use in generating therapeutic grade MSCs. Furthermore, DK can also be used as a model to study molecular mechanisms in delay of senescence of stem cells both in vitro and in animal models. Identification of active ingredients of this formulation, and analysis of their structural characteristics, would help in development of the drug, and use in future clinical therapies.