TABLE 6.
Oligonucleotides used in this studya
| Oligonucleotide | Sequence (5′–3′) | Description |
|---|---|---|
| oVPL49 | ACAATTTCACACAGGAAACAGC | F; insert screening of pVPL3002 |
| oVPL97 | CCCCCATTAAGTGCCGAGTGC | R; insert screening of pVPL3002 |
| oVPL187 | TACCGAGCTCGAATTCACTGG | R; amplifies the pVPL3002 backbone |
| oVPL188 | ATCCTCTAGAGTCGACCTGC | F; amplifies the pVPL3002 backbone |
| oVPL1730 | TGAACCTCAATGTGCCTAGC | F; amplifies the u/s flanking region of the R2lc Δfun deletion cassette |
| oVPL1731 | AATTTAGTTGGGTTATGCTA | R; amplifies the u/s flanking region of the R2lc Δfun deletion cassette |
| oVPL1732 | TTAAAGGTACTGATAATTTCTATC | F; amplifies the d/s flanking region of the R2lc Δfun deletion cassette |
| oVPL1733 | TAGCGGACGTCCTGTAAAGT | R; amplifies the d/s flanking region of the R2lc Δfun deletion cassette |
| oVPL1734 | AAACGACGGCCAGTGAATTCGAGCTCGGTATGAACCTCAATGTGCCTAGCTGGCTTTATA | LCR bridging oligonucleotide to ligate the plasmid backbone + the u/s flanking region of the R2lc Δfun deletion cassette |
| oVPL1735 | TTTTCCCAAATAGCATAACCCAACTAAATTAAGGTACTGATAATTTCTATCAGTAAGTCT | LCR bridging oligonucleotide to ligate u/s and d/s flanking regions of the R2lc Δfun deletion cassette |
| oVPL1736 | AATATTCTTAACTTTACAGGACGTCCGCTAATCCTCTAGAGTCGACCTGCAGGCATGCAA | LCR bridging oligonucleotide to ligate the d/s flanking region of the R2lc Δfun deletion cassette and plasmid backbone |
| oVPL1737 | CGCTATTACGCCAGCTGGCG | F; sequencing of the R2lc Δfun deletion region |
| oVPL1738 | TCTGCTGATGGGCCTATAAAT | R; sequencing of the R2lc Δfun deletion region |
| oVPL1739 | TCGCTGCAAAGAGCAATCT | F; DCO PCR screening for R2lc Δfun |
| oVPL1740 | GGTGATAAAGTCTTGGCTGGAG | R; DCO PCR screening for R2lc Δfun |
| oVPL2334 | AAATATCTCCATGTCCTGGCAATAC | F; amplifies the u/s flanking region of the R2lc Δpks deletion cassette |
| oVPL2335 | TATCCCGACGAGCAAGTAAAG | R; amplifies the u/s flanking region of the R2lc Δpks deletion cassette |
| oVPL2336 | AATGGGGCTGTTATCGTTTTCC | F; amplifies the d/s flanking region of the R2lc Δpks deletion cassette |
| oVPL2337 | AAGCTGTATGGCAGGGCTTTC | R; amplifies the d/s flanking region of the R2lc Δpks deletion cassette |
| oVPL2338 | ACATTTAACCTTTACTTGCTCGTCGGGATAATCCTCTAGAGTCGACCTGCAGGCATGCAA | LCR bridging oligonucleotide to ligate the plasmid backbone and u/s flanking region of the R2lc Δpks deletion cassette |
| oVPL2339 | AAACGACGGCCAGTGAATTCGAGCTCGGTAAATGGGGCTGTTATCGTTTTCCTGTTTTCT | LCR bridging oligonucleotide to ligate the d/s flanking region of the R2lc Δpks deletion cassette and the plasmid backbone |
| oVPL2340 | TCTCCTAAAGAAAGCCCTGCCATACAGCTTAAATATCTCCATGTCCTGGCAATACTAGGT | LCR bridging oligonucleotide to ligate u/s and d/s flanking regions of the R2lc Δpks deletion cassette |
| oVPL2341 | TGTCCTAGCTGATGCTGCAAC | F; DCO PCR screening for R2lc Δpks |
| oVPL2342 | AATAGTTCCAGGGGTGCTTC | R; DCO PCR screening for R2lc Δpks |
| oVPL2518 | TGAAAGTGAGTTGTATGGGTGG | F; amplifies the u/s flanking region of the 2010 Δpks deletion cassette |
| oVPL2519 | TCTAGTTCTCTATAATAATTTACGCGC | R; amplifies the u/s flanking region of the 2010 Δpks deletion cassette |
| oVPL2520 | AACTGTTGGATTTCTTGAAAGTCC | F; amplifies the d/s flanking region of the 2010 Δpks deletion cassette |
| oVPL2521 | AGTCGGGTATTTAGCGCAAATTG | R; amplifies the d/s flanking region of the 2010 Δpks deletion cassette |
| oVPL2522 | AAAACGACGGCCAGTGAATTCGAGCTCGGTAAACTGTTGGATTTCTTGAAAGTCCATAAA | LCR bridging oligonucleotide to ligate the plasmid backbone and u/s flanking region of the 2010 Δpks deletion cassette |
| oVPL2523 | AAGAAAGGCCACCCATACAACTCACTTTCATCTAGTTCTCTATAATAATTTACGCGCTGA | LCR bridging oligonucleotide to ligate u/s + d/s flanking regions of the 2010 Δpks deletion cassette |
| oVPL2524 | GCTTTTTCAATTTGCGCTAAATACCCGACTATCCTCTAGAGTCGACCTGCAGGCATGCAA | LCR bridging oligonucleotide to ligate the d/s flanking region of the 2010 Δpks deletion cassette with the plasmid backbone |
| oVPL2525 | TCTGAAGTAGGTGACGGTGC | F; sequencing of the 2010 Δpks deletion region |
| oVPL2526 | AATCCAATTGTCCCAGGAGTC | R; sequencing of the 2010 Δpks deletion region |
| oVPL2527 | GCTTTTTGTGCTCCTTGACC | F; DCO PCR screening for 2010 Δpks |
| oVPL2528 | TGCCGTTTTCTGAGGTGTCG | R; DCO PCR screening for 2010 Δpks |
| oVPL2856 | AGTGTCATGGCGCATTAACG | F; amplifies the Cm gene of the R2lc Δpks::Cm insertion cassette |
| oVPL2857 | TTATAAAAGCCAGTCATTAGGCC | R; amplifies the Cm gene of the R2lc Δpks::Cm insertion cassette |
| oVPL2858 | TCTCCTAAAGAAAGCCCTGCCATACAGCTTTTATAAAAGCCAGTCATTAGGCCTATCTGA | LCR bridging oligonucleotide to ligate the d/s flanking region of the R2lc Δpks::Cm deletion cassette with the Cm gene |
| oVPL2859 | CCCTTTATTCCGTTAATGCGCCATGACACTAAATATCTCCATGTCCTGGCAATACTAGGT | LCR bridging oligonucleotide to ligate the u/s flanking region of the R2lc Δpks::Cm deletion cassette with the Cm gene |
| oVPL2860 | TGGGAAACAATTTCCCCGAAC | Internal PCR screening for the Cm gene |
| oVPL665 | TCCTCACTCAAGTGGTGCTG | F; amplifies the GAPDH gene in R2lc and its mutants; used for qPCR analyses |
| oVPL666 | ACCGAATGCTGGGTTAGTAG | R; amplifies the GAPDH gene in R2lc and its mutants; used for qPCR analyses |
| oVPL3095 | TGGCAAACCTTTTTGTTGTTCTGG | F; amplifies the funB gene in R2lc and its mutants; used for qPCR analyses |
| oVPL3096 | TCGCATTAATACCTCCAAATCCG | R; amplifies the funB gene in R2lc and its mutants; used for qPCR analyses |
| oVPL3097 | ATGTCAGAATGGGTTTTTGCTGG | F; amplifies the pksB gene in R2lc and its mutants; used for qPCR analyses |
| oVPL3098 | TGATAAGCCGTGCCCTAAAATTTC | R; amplifies the pksB gene in R2lc and its mutants; used for qPCR analyses |
| oVPL395 | ATGCCAGCTACTAAAAAAGAAATCCTTAG | F; amplifies araT in 6475; used for MAMA-PCR |
| oVPL396 | TTAATCCTCCTTATTAATGAAGGCCG | MAMA-PCR oligonucleotide; used for screening L. reuteri 6475 ΔaraT |
| oVPL401 | ACAAAGATTCTTGGTGGGATTCCGATTGAAGTTGATACTTAAGGCGATGATTTTGTTCTCACACCCGCAAGACTCCAAAG | Lagging-strand oligonucleotide that mutates S150X; when incorporated, yields a silent mutation and in-frame stop codon |
| oVPL402 | GGATTCCGATTGAAGTTGATACTTAA | R; amplifies araT in 6475; used for MAMA-PCR |
a
oVPL, van Pijkeren Laboratory oligonucleotide identification number; F, forward; R, reverse; u/s, upstream; d/s, downstream; qPCR, quantitative PCR. The sequence in boldface type indicates a stop codon.