REAGENT or RESOURCE | SOURCE | IDENTIFIER |
---|---|---|
Antibodies | ||
mouse anti-acetylated tubulin - 1:500 | Sigma | Cat# T6793; RRID:AB_477585 |
mouse anti-β-catenin - 1:500 | BD Biosciences | Cat# 610153; RRID:AB_397554 |
rabbit anti-β-catenin -1:1000 | Sigma-Aldrich | Cat# C2206; RRID:AB_476831 |
rat anti-BrdU - 1:250 | Abcam | Cat# ab6326; RRID:AB_305426 |
mouse anti-FoxJ1 -1:300 | Thermo Fisher Scientific | Cat# 14-9965-80; RRID:AB_1548836 |
mouse anti-γ-tubulin - 1:500 | Abcam | Cat# ab11316; RRID:AB_297920 |
rabbit anti-γ-tubulin -1:1000 | Sigma-Aldrich | Cat# T5192; RRID:AB_261690 |
chicken anti-GFAP - 1:1000 | Abcam | Cat# ab4674; RRID:AB_304558 |
rabbit anti-GFAP - 1:1000 | Dako | Cat# Z0334; RRID:AB_10013382 |
chicken anti-GFP (for CFP, YFP) - 1:700 | Aves Labs | Cat# GFP-1020; RRID:AB_10000240 |
rabbit anti-RFP (for tdTomato) - 1:500 | Rockland | Cat# 600-401-379; RRID:AB_2209751 |
rabbit anti-DsRed (for tdTomato) -1:500 | Clontech Laboratories, Inc. | Cat# 632496; RRID:AB_10013483 |
rat anti-VCAM1 - 1:100 | BD Biosciences | Cat# 550547; RRID:AB_393741 |
Secondary antibodies: conjugated to AlexaFluor dyes (donkey or goat polyclonal) |
Thermo Fisher Scientific | N/A |
Bacterial and Virus Strains | ||
QmGFP-OL | Fuentealba et al., 2015 | N/A |
Chemicals, Peptides, and Recombinant Proteins | ||
Tmx | Sigma-Aldrich | Cat# T5648 |
Bromodeoxyuridine (BrdU) | Sigma-Aldrich | Cat# B5002 |
Aqua Poly/Mount medium | Polysciences | Cat# 18606-5 |
Experimental Models: Organisms/Strains | ||
Mouse: Nestin::CreERT2: B6.Cg-Tg(Nes-cre/ERT2)KEisc | A. J. Eisch lab (Lagace et al., 2007) | N/A |
Mouse: Ai14: B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J | The Jackson Laboratory (Madisen etal., 2010) | Cat# 007914 |
Mouse: Confetti: Gt(ROSA)26Sortm1(CAG- Brainbow2.1)Cle/J | The Jackson Laboratory (Snippert etal., 2010) | Cat# 013731 |
Mouse: CD-1 | Charles River Laboratories | Strain Code: 482 |
Mouse: C57BL/6 | Cajal Institute | N/A |
Oligonucleotides | ||
primer S161 (5’-GACAACCACTACCTGAGCACC CAGT-3’) | Fuentealba et al., 2015 | N/A |
primer S126 (5’-GGCTCGTACTCTATAGGCTTCAG CTGGTGA-3’ ) | Fuentealba et al., 2015 | N/A |
primer S160 (5’- ATCACATGGTCCTGCTGGAGTT CGTGA-3’) | Fuentealba et al., 2015 | N/A |
primer S128 (5’- ATTGTTGAGTCAAAACTAGAGC CTGGACCA-3’) | Fuentealba et al., 2015 | N/A |
Recombinant DNA | ||
UbC-StarTrack plasmids | Figueres-Oñate et al., 2016 | N/A |
Software and Algorithms | ||
R version 3.4.3 (2017-11-30) | The R Foundation | N/A |
ImageJ | NIH | N/A |
Stereo Investigator | MBF Bioscience | N/A |
Neurolucida | MBF Bioscience | N/A |
MAFFT version 7 | CBRC, Japan | N/A |
MultiAlin | GenoToul bioinformatics | N/A |
Zeiss PALM MicroBeam LCM (version 4.3.2.13) | Carl Zeiss MicroImaging | N/A |
Other | ||
PEN-membrane slides-2 μm | Leica Microsystems | Cat# 11505158 |