Skip to main content
. Author manuscript; available in PMC: 2019 May 3.
Published in final edited form as: Cell Rep. 2019 Apr 9;27(2):429–441.e3. doi: 10.1016/j.celrep.2019.01.088
REAGENT or RESOURCE SOURCE IDENTIFIER

Antibodies
mouse anti-acetylated tubulin - 1:500 Sigma Cat# T6793; RRID:AB_477585
mouse anti-β-catenin - 1:500 BD Biosciences Cat# 610153; RRID:AB_397554
rabbit anti-β-catenin -1:1000 Sigma-Aldrich Cat# C2206; RRID:AB_476831
rat anti-BrdU - 1:250 Abcam Cat# ab6326; RRID:AB_305426
mouse anti-FoxJ1 -1:300 Thermo Fisher Scientific Cat# 14-9965-80; RRID:AB_1548836
mouse anti-γ-tubulin - 1:500 Abcam Cat# ab11316; RRID:AB_297920
rabbit anti-γ-tubulin -1:1000 Sigma-Aldrich Cat# T5192; RRID:AB_261690
chicken anti-GFAP - 1:1000 Abcam Cat# ab4674; RRID:AB_304558
rabbit anti-GFAP - 1:1000 Dako Cat# Z0334; RRID:AB_10013382
chicken anti-GFP (for CFP, YFP) - 1:700 Aves Labs Cat# GFP-1020; RRID:AB_10000240
rabbit anti-RFP (for tdTomato) - 1:500 Rockland Cat# 600-401-379; RRID:AB_2209751
rabbit anti-DsRed (for tdTomato) -1:500 Clontech Laboratories, Inc. Cat# 632496; RRID:AB_10013483
rat anti-VCAM1 - 1:100 BD Biosciences Cat# 550547; RRID:AB_393741
Secondary antibodies: conjugated to AlexaFluor dyes
(donkey or goat polyclonal)
Thermo Fisher Scientific N/A

Bacterial and Virus Strains
QmGFP-OL Fuentealba et al., 2015 N/A

Chemicals, Peptides, and Recombinant Proteins
Tmx Sigma-Aldrich Cat# T5648
Bromodeoxyuridine (BrdU) Sigma-Aldrich Cat# B5002
Aqua Poly/Mount medium Polysciences Cat# 18606-5

Experimental Models: Organisms/Strains
Mouse: Nestin::CreERT2: B6.Cg-Tg(Nes-cre/ERT2)KEisc A. J. Eisch lab (Lagace et al., 2007) N/A
Mouse: Ai14: B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J The Jackson Laboratory (Madisen etal., 2010) Cat# 007914
Mouse: Confetti: Gt(ROSA)26Sortm1(CAG- Brainbow2.1)Cle/J The Jackson Laboratory (Snippert etal., 2010) Cat# 013731
Mouse: CD-1 Charles River Laboratories Strain Code: 482
Mouse: C57BL/6 Cajal Institute N/A

Oligonucleotides
primer S161 (5’-GACAACCACTACCTGAGCACC CAGT-3’) Fuentealba et al., 2015 N/A
primer S126 (5’-GGCTCGTACTCTATAGGCTTCAG CTGGTGA-3’ ) Fuentealba et al., 2015 N/A
primer S160 (5’- ATCACATGGTCCTGCTGGAGTT CGTGA-3’) Fuentealba et al., 2015 N/A
primer S128 (5’- ATTGTTGAGTCAAAACTAGAGC CTGGACCA-3’) Fuentealba et al., 2015 N/A

Recombinant DNA
UbC-StarTrack plasmids Figueres-Oñate et al., 2016 N/A

Software and Algorithms
R version 3.4.3 (2017-11-30) The R Foundation N/A
ImageJ NIH N/A
Stereo Investigator MBF Bioscience N/A
Neurolucida MBF Bioscience N/A
MAFFT version 7 CBRC, Japan N/A
MultiAlin GenoToul bioinformatics N/A
Zeiss PALM MicroBeam LCM (version 4.3.2.13) Carl Zeiss MicroImaging N/A

Other

PEN-membrane slides-2 μm Leica Microsystems Cat# 11505158