Skip to main content
. 2019 Apr 30;27(5):1551–1566.e5. doi: 10.1016/j.celrep.2019.04.012

Figure 5.

Figure 5

Podocyte-Specific Pgc-1α Knockout Mice Are Viable and Do Not Display a Glomerular Phenotype

(A) Schematic illustrating targeted gene deletion approach of Pgc-1α in podocytes using the Cre-loxP system.

(B) After isolation of podocytes via antibody-based labeling followed by FACS, DNA was prepared and respective genotypes were verified using the following primers: Pgc-1α WT: forward 5′-ACCTGTCTTTGCCTATGATTC-3′, reverse CCAGTTTCTTCATTGGTGTG; Pgc-1α KO forward 5′-TCCAGTAGGCAGAGATTTATGAC-3′, reverse 5′-CCAACTGTCTATAATTCCAGTTC-3′.

(C) In a 22-month follow-up period, no differences in body weight were detected between wild-type and Pgc-1α knockout animals (at least 3 animals per genotype and time point were analyzed; mean ± SD).

(D) Measurement of ACR revealed no differences during the 22-month follow-up period (at least 3 animals per genotype and time point were analyzed; mean ± SD).

(E) PAS-stained kidney sections from 3-month-old and 22-month-old Pgc-1αflox/floxhNPHS2Cre mice and littermate controls showed normal glomerular structure.

(F) TEM images obtained from 22-month-old Pgc-1αflox/floxhNPHS2Cre and littermate controls show normal foot process formation and no difference in mitochondrial shape (representative pictures).