Table 1. Real-time PCR primers.
| Gene | Primer sequence | Product length |
|---|---|---|
| HO-1, NM_012580.2 | AGCGAAACAAGCAGAACCCA | 196 bp |
| GCCACCAGCAGCTCAGGATG | ||
| NQO1, NM_017000.3 | GCGGTGAGAAGAGCCCTGAT | 115 bp |
| ATTCGACCACCTCCCATCCT |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.