Table 2. Identification of the candidate microRNAs, of the three endogenous normalizer microRNA used and of the spike quality control of the analysis.

miR Base ID	NCBI Accession Number	TaqMan Advanced miRNA Assay (ID)	Sequence of the mature miRNA 5’————————— 3’
hsa-miR-26a-5p	MIMAT0000082	477995_mir	UUCAAGUAAUCCAGGAUAGGCU
hsa-miR-223-5p	MIMAT0004570	477984_mir	CGUGUAUUUGACAAGCUGAGUU
hsa-miR-34a-5p	MIMAT0000255	rno481304_mir	UGGCAGUGUCUUAGCUGGUUGU
hsa-miR-191-5p	MIMAT0000440	477952_mir	CAACGGAAUCCCAAAAGCAGCUG
hsa-miR-222-3p	MIMAT0000279	477982_mir	AGCUACAUCUGGCUACUGGGU
hsa-miR-361-5p	MI0000760	481127_mir	UUAUCAGAAUCUCCAGGGGUAC
cel-miR-39-3p	MI0000010	478293_mir	UCACCGGGUGUAAAUCAGCUUG

All the nomenclature is according to miRBase V21 and the TaqMan Advanced miRNA Assays are from Applied Biosystems.