Skip to main content
NCBI home page
The FASEB Journal logoLink to The FASEB Journal
. 2019 Mar 13;33(6):7375–7386. doi: 10.1096/fj.201802653RR

Dysregulation of hypothalamic-pituitary estrogen receptor α–mediated signaling causes episodic LH secretion and cystic ovary

Yukitomo Arao *, Katherine J Hamilton *, San-Pin Wu †, Ming-Jer Tsai ‡, Francesco J DeMayo †, Kenneth S Korach *,1
PMCID: PMC6529333  PMID: 30866655

Abstract

Polycystic ovary syndrome (PCOS) is a hypothalamic-pituitary-gonadal (HPG) axis disorder. PCOS symptoms most likely result from a disturbance in the complex feedback regulation system of the HPG axis, which involves gonadotrophic hormones and ovarian steroid hormones. However, the nature of this complex and interconnecting feedback regulation makes it difficult to dissect the molecular mechanisms responsible for PCOS phenotypes. Global estrogen receptor α (ERα) knockout (KO) mice exhibit a disruption of the HPG axis, resulting in hormonal dysregulation in which female ERα KO mice have elevated levels of serum estradiol (E2), testosterone, and LH. The ERα KO females are anovulatory and develop cystic hemorrhagic ovaries that are thought to be due to persistently high circulating levels of LH from the pituitary. However, the role of ERα in the pituitary is still controversial because of the varied phenotypes reported in pituitary-specific ERα KO mouse models. Therefore, we developed a mouse model where ERα is reintroduced to be exclusively expressed in the pituitary on the background of a global ERα-null (PitERtgKO) mouse. Serum E2 and LH levels were normalized in PitERtgKO females and were comparable to wild-type serum levels. However, the ovaries of PitERtgKO adult mice displayed a more overt cystic and hemorrhagic phenotype when compared with ERα KO littermates. We determined that anomalous sporadic LH secretion caused the severe ovarian phenotype of PitERtgKO females. Our observations suggest that pituitary ERα is involved in the estrogen negative feedback regulation, whereas hypothalamic ERα is necessary for the precise control of LH secretion. Uncontrolled, irregular LH secretion may be the root cause of the cystic ovarian phenotype with similarities to PCOS.—Arao, Y., Hamilton, K. J., Wu, S.-P., Tsai, M.-J., DeMayo, F. J., Korach, K. S. Dysregulation of hypothalamic-pituitary estrogen receptor α–mediated signaling causes episodic LH secretion and cystic ovary.

Keywords: polycystic ovary, negative feedback regulation, gonadotropin

Polycystic ovary syndrome (PCOS) is a common endocrine disorder among women of reproductive age resulting in anovulatory infertility. Symptoms of PCOS appear shortly after puberty but also develop during early adulthood. Women with PCOS typically have an irregular menstrual cycle and often have elevated circulating testosterone. Excess testosterone is responsible for many of the PCOS symptoms, including acne and unwanted or thinning hair. Normally, testosterone in females is produced as a precursor for estradiol (E2) in the theca and interstitial ovarian cells. Because testosterone is converted to E2 by aromatase (Cyp19) in the follicular granulosa cells, serum testosterone levels are typically kept to lower levels in reproductive-age females. Serum sex hormone levels are tightly regulated by the hypothalamic-pituitary-gonadal (HPG) axis in females, which is concurrent with follicular growth in the ovary. PCOS is an HPG axis disorder, but the molecular mechanisms of the associated symptoms are unclear. Worldwide, 5–20% of reproductive-age women are diagnosed as exhibiting PCOS (1). It is important to understand the molecular mechanism of PCOS for development of effective treatments and generation of therapeutic options for patients seeking fertility and symptom relief.

Ovarian E2 blocks LH secretion from the pituitary (negative feedback) until a threshold is reached to stimulate the LH surge (positive feedback) (2). Previous reports have suggested the involvement of estrogen receptor α (ERα) in this negative and positive feedback regulation using the global and tissue-specific ERα knockout (KO) mouse models (2, 3). The phenotype of the global ERα KO (αERKO) female has been described with elevated serum E2, testosterone, and LH levels causing disruption of negative feedback regulation (3). The αERKO females also possess cystic and hemorrhagic ovaries (4). A similar phenotype was observed in bLHβCTP transgenic (Tg) female mice, which expresses the stable bovine Lhb subunit, causing consistently elevated serum LH levels (5, 6). From these results, it has historically been thought that persistently high serum LH causes cystic and hemorrhagic ovaries, which were observed in both mouse models. However, this has been an area of debate because persistently high serum LH levels are not commonly seen in PCOS patients.

ERα is expressed in all the tissues comprising the HPG axis. Recent efforts using the tissue-selective KO technology have shed light on the functions of hypothalamic and pituitary ERα (2, 7–9). There have been 2 reports of pituitary-specific ERα KO (PitERα KO) mouse lines generated using the choriogonadotropin α subunit promoter fused cre (Cga-cre), also known as the αGSU-cre, Tg mice crossed with the Esr1flox/flox mouse line (7, 8). Findings from those studies suggested that the PitERα KO female was infertile and/or subfertile with cystic ovaries. However, those studies reported inconsistent serum LH levels and varied in the severity of the ovarian cysts in the PitERα KO females. One study showed normal LH levels, and the other report showed elevation over the wild-type (WT) levels. Because of the inconsistency between the 2 studies that used the same promoter-fused Cre-recombinase expression mouse, we decided to develop a unique model to evaluate the pituitary ERα functionality.

We generated a novel mouse model that reintroduces the expression of ERα exclusively in the pituitary on the pituitary-only ERα-expressing (PitERtgKO) mouse background to evaluate the functionality of pituitary ERα. In the PitERtgKO females, serum E2 and LH levels were normalized to a similar level as WT females in contrast to the elevated levels seen in αERKO females. However, PitERtgKO females possessed more severe hemorrhagic ovaries than αERKO females even though LH levels were normalized. Further analyses of PitERtgKO mice suggest that abnormal sporadic LH secretion can cause the cystic and hemorrhagic ovarian phenotype. Our observation provides new insight into the role of ERα in the development of the cystic ovarian phenotype.

MATERIALS AND METHODS

Animals

All experiments involving animals were carried out according to U.S. Public Health Service guidelines. Studies were approved by the National Institute of Environmental Health Sciences Institutional Animal Care and Use Committee. Animals were maintained on a National Institutes of Health (NIH)-31 regular chow (Harlan Laboratories, Indianapolis, IN, USA). The generation of mice lacking the exon 3 corresponding region of Esr1 gene (Ex3αERKO) has been previously reported (10). The generation of mice containing a Cre-dependent inducible human ERα transgene on the Rosa26 locus (Rosa26-LSL-hERα) has also been previously reported (11). Briefly, the Myc-FLAG tandem tagged full length human ESR1 cDNA was cloned into a minigene, which contains CAGGS promoter and a floxed Stop cassette (12). The ESR1-carrying minigene was inserted into the Rosa26 locus of mouse AB2.2 embryonic stem cells by gene targeting. The targeted AB2.2 cells were subsequently maintained in the 129/C57BL/6J hybrid background. B6;SJL-Tg(Cga-cre)3Sac/J mouse, which expresses the Cre recombinase specifically in the anterior and intermediate lobes of the pituitary gland (13) was purchased from The Jackson Laboratory (Bar Harbor, ME, USA). The following breeding steps were carried out to generate the Esr1 KO mouse that expresses ERα only in the pituitary (PitERtgKO). The Rosa26-LSL-hERα heterozygous mice were crossed with the Ex3αERKO heterozygous mice, and the resulting offspring (Esr1+/−-Rosa26+/lslESR1) were used to generate Esr1+/−-Rosa26lslESR1/lslESR1 mice. Meanwhile, the Tg(Cga-cre) mice were crossed with the Ex3αERKO heterozygous mice to generate Esr1+/−-Tg(Cga-cre) mice. Esr1+/−-Rosa26lslESR1/lslESR1 mice and Esr1+/−-Tg(Cga-cre) mice were crossed to generate Esr1−/−-Rosa26+/lslESR1-Tg(Cga-cre) mice and are described as PitERtgKO. The littermates without Tg(Cga-cre) (Esr1−/−-Rosa26+/lslESR1) were used as ERαKO mice, and the genotype of Esr1+/+-Rosa26+/lslESR1 mice were used as WT control.

Sample collection

The animals were euthanized with carbon dioxide. Blood was collected from the descending aorta into BD Microtainer serum separator tubes (Becton, Dickinson and Company, Franklin Lakes, NJ, USA). Separated serum was stored in −70°C until measuring serum hormone levels. For RNA and protein extraction, the dissected tissues were frozen in liquid nitrogen and stored in −70°C. The tissues were fixed in 10% neutral buffered formalin for histologic assessment.

Tissue protein extractions and Western blot analyses

The frozen tissues were pulverized then homogenized with the buffer containing 50 mM Tris/HCl (pH 7.5), 150 mM NaCl, 1% Triton X-100, 6 mM sodium deoxycholate, 20 µg/ml aprotinin, 20 µg/ml leupeptin, 4 µg/ml PMSF, and phosphatase inhibitor cocktail (MilliporeSigma, Burlington, MA, USA). The homogenate was centrifuged, and then supernatant was stored at −70 °C until samples were analyzed on SDS-PAGE. Twenty micrograms of proteins was resolved on SDS-PAGE and subsequently transferred to nitrocellulose membranes. Blots were incubated overnight in 4°C with primary antibody for human ERα (1:650; HC-20; Santa Cruz Biotechnology, Dallas, TX, USA) or mouse ERα (1:650; MC-20; Santa Cruz Biotechnology). The blots were washed and then incubated with IRDye 800CW-conjugated anti-rabbit antibody (Li-Cor Biosciences, Lincoln, NE, USA). The signals were visualized by Odyssey Infrared Imaging System (Li-Cor Biosciences). The ERα blots were stripped by Restore Western Blot Stripping Buffer (Thermo Fisher Scientific, Waltham, MA, USA) and then incubated overnight in 4°C with primary antibody for β-actin (1:2000; AC-74; MilliporeSigma). The blots were washed then incubated with IRDye 680CW-conjugated anti-mouse antibody (Li-Cor Biosciences).

RNA extraction and quantitative PCR

Frozen tissues were homogenized and total RNA was extracted by Trizol Reagent (Thermo Fisher Scientific). Extracted RNA was reverse transcribed to make cDNA, then real-time PCR was performed as previously described (14). The primer sets are described in Table 1. Samples were analyzed in duplicate, and the Rpl7 mRNA was used as an internal control for all analyses. Relative expression levels were determined using the mathematical model described by Pfaffl (15).

TABLE 1.

Primer sets for quantitative PCR

Primer sequence, 5ʹ–3ʹ
Gene Forward Reverse
hESR1 TAGAGGGCATGGTGGAGATCTT CAAACTCCTCTCCCTGCAGATT
mEsr1 AGGACCACATCCACCGTGTC GGGATTCTCAGAACCTTTCGG
Lhb CACCTTCACCACCAGCATCT GCACACGAGGCAAAGCA
Cga CTGTGTGTCACCACCTCCTC GACGGAACCGTGGTAAATA
Cyp17a1 CCCATCTATTCTCTTCGCCTGGGTA GCCCCAAGATGTCTCCCACCGTG
Cyp19a1 TGCACAGGCTCGAGTACTTCC GCGGGGCCCAAAGCCAAAAG
Hsd3b1 CCAGGCAGACCATCCTAGATGT TGGCACACTTGCTTGAACACA
Hsd3b6 TCTCCAGGGTCACTGTACATTAATCTCACAC CCTTGATGTTTGTATCTAGGTTGAAGAATTGC
Hsd17b1 CTGCGTGGTTATGAGCAAGC CGCATTGCAGTCAAGAAGAGC
Hsd17b3 ATGGGCAGTGATTACCGGAG TTAGAGTCCATGTCTGGCCAA
Ptgs2 CAGGAGAGAAGGAAATGGCTG CAAAGATAGCATCTGGACGAGG
Btc AATTCTCCACTGTGTGGTAGCA GGTTTTCACTTTCTGTCTAGGGG
Areg GCGCGCTCAGTGCTGTT GGGTCATTGAGCTCCAAAGC
Cebpb CGGGTTTCGGGACTTGATGCAAT CTAGACAGTTACACGTGTGTTGCG
Lhcgr CACCATACCAGGGAACGCTT CAGCGAGATTAGCGTCGTCC
Adamts1 TTTTTCGTCTTACAGCCCAAGG CCACAAACGCCACACTTATCA
Timp1 GCAACTCGGACCTGGTCATAAG TGTAGGCGTACCGGATATCTGC
Mmp19 GATGAGGAGGAAGAGACCGAGATGC TTACAGTCCACACATAGTCGCCCTTG
Gnrhr TGCTCGGCCATCAACAACA GGCAGTAGAGAGTAGGAAAAGGA
Ptpn5 ACGAGAAGAGTCAGCCCATGAGTATCTG CTGTGAGGATTGGGAAGGATGGTTTTGT
Rpl7 AGCTGGCCTTTGTCATCAGAA GACGAAGGAGCTGCAGAACCT
Open in a new tab

Serum gonadotropin and steroid hormone assays

All hormone assays were carried out on serum from individual animals. Serum LH levels were measured in singlicate from a 20-µl sample per animal using the sensitive dissociation-enhanced lanthanide fluoroimmunoassay, a modified method of sandwich ELISA. Briefly, the LH in the sample was captured by the biotinylated anti-mouse LH antibody then trapped on the streptavidin-coated plate; the captured LH on the plate was detected by the lanthanide-labeled anti-mouse LH antibody. The anti-mouse LH antibody used for dissociation-enhanced lanthanide fluoroimmunoassay was provided by Dr. Deborah Best (Environmental Protection Agency, Durham, NC, USA). Serum E2 and testosterone levels were analyzed by The Ligand Assay and Analysis core at University of Virginia School of Medicine (Charlottesville, VA, USA).

Treatment of GnRH inhibitor

Four-week-old female mice were injected with 100 µl saline containing 60 µg degarelix acetate, also known as Firmagon (Bachem, Bubendorf, Switzerland), and 75 µg mannitol (MilliporeSigma) subcutaneously every 2 wk for 4 wk. The vehicle group was treated with 100 µl saline containing 75 µg mannitol.

Serial LH collection

Blood for measuring serial LH levels was collected from the tail tip every 10 min for 6 h (9 am to 3 pm). Five microliters of blood was collected from PitERtgKO (10 wk old) and ERαKO (10 wk old) females each time. The collected blood was mixed with 45 µl PBS with Tween 20 then frozen on dry ice quickly (16). LH assay was performed using the 20 µl of PBS with Tween 20–diluted blood in the method previously described.

Intermittent LH injection procedure

Four-month-old CD-1 female mice were implanted with the iPrecio microinfusion pumps (SMP-300, Primetech, Tokyo, Japan) subcutaneously and the injection line from the pump was surgically placed into the body cavity to ensure intraperitoneal injection from the pump. Because of the large size of this pump, we used CD-1 mice (which were 25–29 g body weight) for this experiment. Additionally, a 1-wk limit for implantation was approved as the maximum duration by the National Institute of Environmental Health Sciences Institutional Animal Care and Use Committee. The iPrecio pump was programmed for intermittent injection of human chorionic gonadotropin (hCG), an analog of LH, by iPrecio management software (Primetech). The injection scheme was as follows: 0.4 IU/µl hCG suspended in saline was injected with 10 µl/h flow rate for 6 min (1 µl) then rest for 300 min (5 h). This process was repeated for 1 wk.

Assessment of negative feedback regulation

Six- to 8-wk-old mice were ovariectomized (Ovx). For acute estrogen response analysis, 4 wk after surgery the mice were injected with 200 ng/mouse E2 (Steraloids, Newport, RI, USA) suspended in PBS or 100 µl PBS (vehicle) intraperitoneally for 3 h. For chronic estrogen response analysis, 4 wk after surgery the mice were injected with 5 µg/mouse E2-benzoate (EB; MilliporeSigma) suspended in corn oil or 100 µl corn oil (vehicle) s.c. every 48 h for 96 h.

Statistics

Statistical analyses were performed by Prism 7 (GraphPad Software, La Jolla, CA, USA). A 1-way ANOVA with Tukey’s multiple-comparison test was used for analyzing the differences among multiple groups. A Mann-Whitney U test (2-tailed) was used for analyzing the differences between 2 groups. Significance level set at P < 0.05 for every analysis.

RESULTS

Establishment of the animal model that expresses ERα exclusively in pituitary

We tried a novel strategy and approach to test functionality of pituitary ERα in the HPG axis using a new animal model, which has ERα expression only in the pituitary. Details are described in the Materials and Methods. Briefly, the expression of Cre recombinase–dependent inducible human ERα transgene on the Rosa26 locus, Rosa26+/lslESR1, is regulated by the Cga (αGSU) promoter-fused cre recombinase, Tg(Cga-cre), that is expressed specifically in the anterior and intermediate lobes of the pituitary gland. The Esr1 null homozygote mouse containing Rosa26+/lslESR1 and Tg(Cga-cre) [Esr1−/−-Rosa26+/lslESR1-Tg(Cga-cre)] was named PitERtgKO. We used littermates without Tg(Cga-cre) (Esr1−/−-Rosa26+/lslESR1) as ERαKO mice and the Esr1+/+-Rosa26+/lslESR1 without Tg(Cga-cre) mice as WT control. To verify this model, the expression levels of human and mouse ERα protein (Fig. 1A) and mRNA (Fig. 1B) were analyzed. Human ERα protein was detected in the PitERtgKO pituitary. The expression level of human ERα mRNA in the PitERtgKO pituitary was significantly higher than WT, which was determined as the background level. As expected, endogenous mouse ERα in the PitERtgKO pituitary was expressed at the same level as ERαKO. Leaky expression of Cre recombinase in the Tg(Cga-cre) ovary has been discussed (17, 18). However, expression of human ERα protein in the PitERtgKO ovary was rarely observed, consistent with the expression profile of human ERα mRNA in the PitERtgKO. We concluded that the line of Tg(Cga-cre) mice that we utilized does not have regular ovarian expression, and therefore, the phenotypes of PitERtgKO females that we observed are pituitary ERα dependent.

Figure 1.

Figure 1

Open in a new tab

PitERtgKO expresses ERα exclusively in the pituitary. A) Whole tissue lysates extracted from the pituitary and ovary of PitERtgKO (TG), ERαKO (KO), or control (WT) females at 3 mo of age were analyzed by immunoblotting with anti-human ERα antibody (HC-20) to demonstrate the expression levels of Tg ERα and anti-mouse ERα antibody (MC-20) to demonstrate the expression levels of endogenous ERα. β-Actin was used as a loading control (Actin). Representative Western blot is shown. Ut WT indicates a reference of endogenous mouse uterine ERα. Arrow heads indicate ERα protein. An asterisk indicates nonspecific bands. M denotes molecular size marker. B) The expression level of human and mouse ERα mRNA (hERα and mERα) in the pituitary and ovary of WT (n = 6), TG (n = 6), and KO (n = 6) females at 3 mo of age was quantified by real-time PCR. The expression level was normalized by Rpl7 mRNA level. The relative mRNA levels are shown; TG was set as 1 for hERα mRNA level, and WT was set as 1 for mERα mRNA level. Nd denotes undetectable mRNA level. Ns, nonsignificant difference. The mean ± sem is indicated. ****P < 0.0001, ***P < 0.001, **P < 0.01 (1-way ANOVA with Tukey’s multiple-comparison test).

Estrogen negative feedback on gonadotropin secretion was restored in PitERtgKO

Because of the disruption of estrogen negative feedback regulation on gonadotropin secretion, it has been reported that the serum LH, E2, and testosterone levels were persistently higher in ERα KO females when compared with WT females. At first, we analyzed the serum LH, E2, and testosterone levels in PitERtgKO, ERαKO, and WT control females. The serum LH and E2 levels were significantly lower in PitERtgKO females than in ERαKO and in fact were the same level as WT control females (Fig. 2A, B). However, the serum testosterone level was not lowered in PitERtgKO females, which differered from the regulation of LH and E2 (Fig. 2C). We analyzed the expression level of LH peptide coding genes in the pituitary (Lhb and Cga) and ovarian steroidogenic enzyme genes (Cyp17a1, Cyp19a1, and Hsd17b3) by quantitative PCR. As reflected in the serum LH levels, the mRNA levels of Lhb and Cga in the PitERtgKO pituitary were lower than in the ERαKO pituitary (Fig. 2D, E). The expression level of ovarian estrogen synthesis–related genes, Cyp17a1 and Cyp19a1, was significantly lower in PitERtgKO than in ERαKO, reflecting the lower serum E2 level (Fig. 2F, G). Aberrant expression of the testicular testosterone synthesis enzyme gene, Hsd17b3, was observed in the ERαKO ovary as previously reported (3) and was also seen in the PitERtgKO ovary (Fig. 2H). These results suggested that the selective expression of ERα in the pituitary of PitERtgKO females restored estrogen negative feedback regulation of LH secretion, but aberrant elevated testosterone synthesis in the ovary was still observed.

Figure 2.

Figure 2

Open in a new tab

Serum hormone levels and pituitary and ovarian gene expression profile. Serum hormone levels in the 3-mo-old control (WT, n = 5), PitERtgKO (TG, n = 8), and ERαKO (KO, n = 8) females were analyzed. A–C) LH (A), E2 (B), and testosterone (C) levels are shown. The mean ± sd is indicated. The gene expression levels in the 3-mo-old WT (n = 5), TG (n = 8), and KO (n = 8) females were quantified by real-time PCR. D, E) The expression levels of LH subunit coding genes, Lhb (D) and Cga (E), in the pituitary are show. F–H) Ovarian gene expression level of E2 synthesis–related enzymes, Cyp17a1 (F) and Cyp19a1 (G), and testosterone synthesis enzyme, Hsd17b3 (H), is shown. The gene expression level was normalized by Rpl7 mRNA level. Relative mRNA levels are shown; WT was set as 1. Ns, nonsignificant difference. Mean ± sem is indicated. ****P < 0.0001, ***P < 0.001, **P < 0.01, *P < 0.05 (1-way ANOVA with Tukey’s multiple-comparison test).

Cystic ovarian phenotype in PitERtgKO is more severe than ERαKO

We have previously reported that ERα KO females possess cystic and hemorrhagic ovaries that are caused by the persistent elevation of the serum LH level. As we have shown, the serum LH level in PitERtgKO females was restored to the WT level, but surprisingly, the PitERtgKO females possess consistently more severe cystic and hemorrhagic ovaries than seen in the ERαKO ovary (Fig. 3A and Supplemental Data). We analyzed the gene expression profile, focusing on the LH-responsive ovarian genes, and found elevated aberrant expression of Ptgs2, Btc, Areg, and Cebpb in PitERtgKO adult females but not in ERαKO or WT control ovaries (Fig. 3B). Interestingly, these genes are known LH early responsive genes in the WT ovary in which the transient expression is observed 4 h after LH (hCG) treatment (19). The aberrant expression level of Ptgs2 and Areg was similar to the level seen in 4-h hCG-treated WT ovary, but the levels of Btc and Cebpb were lower (unpublished results). In contrast, LH late responsive genes, Adamts1, Timp1, and Mmp19 were not aberrantly expressed. Additionally, there was no difference in the LH receptor gene (Lhcgr) expression level between genotypes.

Figure 3.

Figure 3

Open in a new tab

Distinct ovarian phenotype and gene expression profile between PitERtgKO and ERαKO. A) Morphology of female reproductive organs (left panels) and histology of ovary (right panels) in the 3-mo-old representative mice from each genotype are shown; WT, control; TG, PitERtgKO; KO, ERαKO. Scale bars (left), 1 cm; scale bars (right), 0.2 mm. The reproducibility of morphology of female reproductive organs is shown in the Supplemental Data. B) The ovarian gene expression level of WT (n = 5), TG (n = 8), and KO (n = 8) was quantified by real-time PCR. The expression level was normalized by Rpl7 mRNA level. Relative mRNA levels are shown; WT was set as 1. The mean ± sem is indicated. ****P < 0.0001, ***P < 0.001, **P < 0.01, *P < 0.05 (1-way ANOVA with Tukey’s multiple-comparison test).

Severe hemorrhagic ovarian phenotype of PitERtgKO was prevented by GnRH inhibitor

Because of the normalized serum LH level in PitERtgKO mice, we verified the involvement of LH in the overt cystic and hemorrhagic ovary phenotype and abnormal gene expression using a GnRH antagonist (degarelix acetate). After degarelix acetate treatment, the serum LH levels were abrogated completely in female mice (Fig. 4A), and the severity of the cystic and hemorrhagic ovarian phenotype of the PitERtgKO was reduced (Fig. 4B). At the same time, the abnormal gene expression in the PitERtgKO and ERαKO mice was normalized (Fig. 4C). Furthermore, the serum testosterone level was reduced with the reduction of ovarian Hsd17b3 gene expression in PitERtgKO and ERαKO females (Fig. 4D, E). These results suggested that the severe hemorrhagic ovaries in the PitERtgKO females were the result of a gonadotropin-mediated event even though the serum LH level was seemingly normalized in the PitERtgKO females.

Figure 4.

Figure 4

Open in a new tab

LH is involved in the severity of ovarian phenotype. A) Serum LH level in the 4-wk degarelix- (GnRH inhibitor; De) or vehicle (V)-treated control (WT; V, n = 6; De, n = 7), PitERtgKO (TG; V, n = 4; De, n = 4), and ERαKO (KO; V, n = 4; De, n = 4) females. The value of mean ± sem is also indicated. B) representative histology of 4-wk De- or V-treated WT and TG ovaries. Scale bars, 0.2 mm. C) The ovarian gene (Btc, Areg and Ptgs2) expression levels in the 4-wk De- or V-treated female mice. mRNA levels were quantified by real-time PCR. The expression level was normalized by Rpl7 mRNA level. Relative mRNA levels are shown; V-treated WT was set as 1. The mean ± sem is indicated. D) Serum testosterone level in the 4-wk De- or V-treated female mice. The mean ± sem is indicated. E) The expression level of ovarian Hsd17b3 in the 4-wk De- or V-treated females was quantified by real-time PCR. The expression level was normalized by Rpl7 mRNA level. Relative mRNA level is shown; V-treated WT was set as 1. Ns, nonsignificant difference. The mean ± sem is indicated. ****P < 0.0001, **P < 0.01, *P < 0.05 (1-way ANOVA with Tukey’s multiple-comparison test to indicate significant difference between treatment in each genotype.).

Differential LH secretion profiles between PitERtgKO and ERαKO females

We analyzed the serial LH secretion profile for 6 h. Five microliters of blood was collected from the tail tip every 10 min. The profiles of a WT male and female mouse are shown as reference (Fig. 5A, top panels). As shown, no detectable peak was observed in the WT female during this daytime period. In contrast, a few peaks were detected during this period in the WT males. We observed variation of pulse frequency in PitERtgKO females; some animals showed no detectable peaks during this period (Fig. 5B). The left bottom panels in Fig. 5A show the profiles of low pulse frequency (TG-3) and high pulse frequency (TG-9) in PitERtgKO females. Of note, the amplitude of the peaks did not vary in the PitERtgKO female mice. On the other hand, variation of peak amplitude was notable in ERαKO females, whereas pulse frequency was less variable. The right bottom panels in Fig. 5A show examples of the lowest (KO-1) and the highest (KO-8) detected peak amplitude profiles in ERαKO females. Interestingly, the profile of the highest pulse frequency in PitERtgKO (Fig. 5A; TG-9) was similar to the lowest peak amplitude profile of ERαKO female (Fig. 5A; KO-1). These results suggest that the pituitary ERα attenuates GnRH sensitivity for LH secretion. We hypothesized that the intermittent abnormal sporadic secretion of LH in the PitERtgKO female, which was different from ERαKO and WT females, may induce aberrant gene expression and cause the severe hemorrhagic ovarian phenotype.

Figure 5.

Figure 5

Open in a new tab

Serial LH secretion profile. A) Measurements of circulation levels of whole-blood LH over a 6-h sampling period (9 am–3 pm). Five-microliter whole-blood samples were collected at 10-min intervals. Representative profiles of a WT female (n = 1) and WT male (n = 3) are shown in the top panels. The lowest (TG-3) and the highest (TG-9) profiles of differential pulse frequency in PitERtgKO (PitTG) females are shown in bottom left panels. The lowest (KO-1) and the highest (KO-8) profiles of differential pulse amplitude in ERαKO females are shown in bottom right panels. B) The scatterplot of LH level over a 6-h sampling period of individual PitERtgKO (PitTG) and ERαKO females. The black and red lines show the mean value. The identification number of animals is correlated with the profiles shown in the first panel.

Intermittent LH treatment generated cystic and hemorrhagic ovaries in the WT females

In an attempt to test and recreate the sporadic LH secretion profile, which was observed in PitERtgKO females, WT CD-1 females were treated with intermittent injections of hCG (0.4 IU; an analog of LH) every 5 h for 1 wk using the programmed injection pump system, iPrecio. The injected hCG concentration was one-sixth that used for a typical super ovulation protocol in mice. The treatment of continual intermittent injections of hCG resulted in cystic and hemorrhagic ovaries in the WT females, although the phenotype was more moderate than observed in the PitERtgKO ovaries (Fig. 6A). Of note, we did not observe any cystic and hemorrhagic ovaries in the animals that received shorter intermittent injections (every 3.5 h) of hCG (0.4 IU) for 1 wk (unpublished results). It is known that hCG is a stable LH analog; it is likely that shorter periodic hCG injections did not produce sufficient intervals to recreate the sporadic LH secretion profile. This result is supportive of our hypothesis that the sporadic LH exposure causes the cystic ovarian phenotype rather than the persistent LH exposure. In this study, cystic and hemorrhagic ovaries were never observed in the vehicle-treated WT females. We analyzed the expression levels of Ptgs2, Btc, and Areg genes that were expressed in the steady state PitERtgKO ovary exclusively (Fig. 3B). We found that the expression levels of Ptgs2 and Areg genes were significantly higher in the hCG-treated ovaries, but Btc expression was not increased to a statistically significant level (Fig. 6B). Additionally, we analyzed the gene expression level of LH receptor coding gene, Lhcgr. The mRNA level of Lhcgr was slightly higher in the hCG-treated ovaries compared with the vehicle-treated ovaries, but that level was not statistically significant. These profiles were similar to the steady state level of PitERtgKO ovarian genes (Fig. 3B). The expression levels of 17β-hydroxysteroid dehydrogenase (HSD) and 3β-HSD coding genes were analyzed (Fig. 6C, D, respectively). It is known that Hsd17b1 and Hsd3b1 are ovarian HSDs and Hsd17b3 and Hsd3b6 are testicular HSDs that contribute to produce E2 and testosterone, respectively (20, 21). No difference was observed in the expression of Hsd17b1 and Hsd3b1 between vehicle- and hCG-treated ovaries. Interestingly, the mRNA levels of Hsd17b3 and Hsd3b6 were elevated in the hCG-treated ovary. However, the expression levels of Hsd17b3 and Hsd3b6 were notably lower than the expression levels of Hsd17b1 and Hsd3b1; the mean Ct value of Hsd17b3 was 34.33, and that of Hsd17b1 was 23.95; the mean Ct value of Hsd3b6 was 34.34, and that of Hsd3b1 was 19.63. The serum testosterone level was slightly higher in the hCG-treated mice compared with the vehicle-treated group, although these testosterone levels were distributed in the normal range of intact CD-1 females (Fig. 6E). The serum E2 level was not altered in hCG-treated mice (Fig. 6F), which corresponds with the expression level of ovarian Cyp19a1 (Fig. 6G). These results suggest that the unusual intermittent secretion of LH in females can cause cystic ovaries and that it coincides with higher testosterone levels.

Figure 6.

Figure 6

Open in a new tab

Intermittent LH exposure induces cystic hemorrhagic ovary. A) Representative histology of WT CD-1 female ovary that was treated with episodic (5-h intervals) 0.4 IU hCG (n = 6) or vehicle (veh, n = 6) for 1 wk. Original magnification, ×4. B) The gene expression levels of Ptgs2, Btc, Areg, and Lhcgr in the 1-wk episodic hCG- or vehicle-treated ovaries. C) The expression levels of 17β-HSD coding genes in the 1-wk episodic hCG- or vehicle-treated ovaries. D) The expression levels of 3β-HSD coding genes in the 1-wk episodic hCG- or vehicle-treated ovaries. The mRNA level was quantified by real-time PCR. The expression level was normalized by Rpl7 mRNA level. Relative mRNA levels are shown; vehicle-treated sample was set as 1. The mean ± sem is indicated. **P < 0.01, *P < 0.05 (2-tailed Mann-Whitney U test). E, F) Serum testosterone (E) and E2 (F) levels in 1-wk episodic hCG- or vehicle-treated WT CD-1 females. Intact CD-1 shows the serum hormone levels that were randomly collected from CD-1 females. Pump shows the hormone levels of 1-wk episodic hCG- or vehicle-treated WT CD-1 females. The mean ± sd is indicated. *P < 0.05 (1-way ANOVA with Tukey’s multiple-comparison test to indicate significant difference between treated animals). G) The gene expression level of Cyp19a1 in the 1-wk episodic hCG- or vehicle-treated ovaries was quantified by real-time PCR. Ns, nonsignificant difference; V, vehicle treated.

Pituitary ERα regulates LH secretion rather than LH gene regulation

To evaluate the functionality of pituitary ERα in the negative feedback regulation, Ovx PitERtgKO females were administered estrogen. To examine the acute estrogen response, the mice were treated with E2 for 3 h (Fig. 7A). To examine the chronic estrogen response, the mice were administered with EB for 96 h (Fig. 7B). Ovx-mediated elevated serum LH level was reduced by 96 h of EB treatment in both WT control and PitERtgKO females but not in ERαKO females. However, the 3-h E2 treatment did not decrease LH levels in Ovx PitERtgKO females, whereas the reduction of serum LH was observed in WT control females. The gene expression of Lhb was not regulated by 3 h of E2 treatment in any genotype (Fig. 7C). In contrast, Lhb gene expression was reduced in the 96-h EB-treated WT control females; however, the PitERtgKO pituitary was unresponsive to the 96-h EB treatment being different from WT control females (Fig. 7D). These results suggest that pituitary ERα is involved in the negative feedback regulation of serum LH levels, controlling the secretion rather than the gene regulation of LH in pituitary. It has been reported that the expression of the Lhb gene is regulated by GnRH-mediated ERK signaling (22). The expression level of Gnrhr was not changed by EB treatment in the PitERtgKO and ERαKO pituitary, whereas it was slightly reduced in the EB-treated WT control (Fig. 7E).

Figure 7.

Figure 7

Open in a new tab

Confirmation of pituitary ERα functionality for estrogen negative feedback regulation of LH. A) Effect of acute estrogen treatment for negative feedback regulation. The Ovx mice were treated with vehicle (V) or E2 (200 ng/mouse) for 3 h; then, serum LH levels were determined. LH levels of Control (WT; V, n = 9; E2, n = 9), PitERtgKO (TG; V, n = 7; E2, n = 7), and ERαKO (KO; V, n = 7; E2, n = 7) females were analyzed twice. Every result is plotted. Mean ± sem is also indicated. The LH levels of intact females (WT, TG, and KO) are shown as a reference. B) Effect of chronic estrogen treatment for negative feedback regulation. The Ovx mice were treated with vehicle or EB (5 µg/mouse administer every 48 h) for 96 h, and then serum LH levels were determined. LH levels of WT (V, n = 7; EB, n = 5), TG (V, n = 7; EB, n = 7), and KO (V, n = 5; EB, n = 7) females were analyzed twice. Every result is plotted. Means ± sem are indicated. The LH levels of intact females (WT, TG, and KO) are shown as a reference. C) The gene expression level of Lhb in the 3-h E2-treated pituitary was quantified by real-time PCR. D) The gene expression level of Lhb in the 96-h EB-treated pituitary was quantified by real-time PCR. E) The gene expression level of Gnrhr in the 96-h EB-treated pituitary was quantified by real-time PCR. The expression level was normalized by Rpl7 mRNA level. Relative mRNA levels are shown; vehicle-treated WT was set as 1. Means ± sem are indicated. Ns, nonsignificant difference; V, vehicle. One-way ANOVA with Tukey’s multiple comparison test was performed to indicate significant difference between treatment in each genotype. ****P < 0.0001, **P < 0.01, *P < 0.05.

DISCUSSION

PCOS is an HPG axis disorder affecting the ovary. The symptoms of PCOS most likely result from the disturbance of complex feedback regulation involving gonadotrophic hormones and ovarian steroid hormones. However, the nature of this feedback regulation makes it difficult to dissect the molecular mechanisms responsible for PCOS phenotypes. Our studies, described herein, document a role of pituitary ERα-dependent estrogen signaling in the HPG feedback regulation and ovarian responses.

It was surprising that the expression of human ERα in the PitERtgKO female mouse pituitary causes a more severe hemorrhagic ovarian phenotype than observed in ERαKO females, even though the serum LH level was normalized. The experiment using a GnRH antagonist clearly suggests that gonadotropins are involved in influencing the development of the severe hemorrhagic phenotype of the PitERtgKO ovary. Historically, it has been thought that persistently high LH causes cystic and hemorrhagic ovaries in PitERtgKO female mice (6). This hypothesis was supported by the cystic and hemorrhagic ovarian phenotype of bLHβCTP Tg mice, which express the stable bovine Lhb subunit to extend LH half-life in the serum, causing persistently high serum LH (5). Our observations in this study suggest that the LH secretion profile, rather than persistently high serum LH level, is an important factor to induce cystic and hemorrhagic ovaries.

The normalized serum LH level in the PitERtgKO females was concurrent with reduction of the LH subunit coding genes (Lhb and Cga) in the pituitary. This profile was strikingly different from ERαKO females. Interestingly, Lhb mRNA level in the Ovx PitERtgKO pituitary was not reduced by acute or chronic estrogen treatments, even though the steady state level of Lhb mRNA was normalized in the adult intact PitERtgKO females. Additionally, the expression level of Lhb gene in the Ovx WT control female was reduced by chronic estrogen treatment but not acute treatment. In contrast, a reduction of serum LH level was observed in the Ovx WT control females regardless of the estrogen treatment scheme. These results suggest that the pituitary ERα does not regulate Lhb gene expression directly to control negative feedback regulation. This is consistent with the previous reports that suggest that the expression of the Lhb gene is regulated by GnRH-mediated ERK1/2 signaling in the murine gonadotropic cells (22). The expression level of Gnrhr was slightly reduced by EB treatment, which coincided with the down-regulation of Lhb gene expression in the WT pituitary; however, this response was not observed in PitERtgKO and ERαKO females. It is likely that pituitary ERα regulates the expression of genes controlling the LH secretion machinery rather than GnRH signaling, such as Gnrhr.

ERα functionalities in the pituitary and hypothalamus for negative feedback regulation have been investigated using the rodent model (2, 7, 8). The studies from Shaw et al. (23) suggest that the pituitary could be a direct target of estrogen negative feedback regulation in humans based on the findings that administration of E2 to women reduced their LH secretion responses to GnRH (hCG) treatment. Our animal study supports their study. These observations suggest distinct roles of the pituitary and hypothalamus ERα for controlling gonadotropin secretion. Clomiphene citrate has been given to anovulatory infertile women to enhance ovulation (24). Clomiphene is a selective estrogen receptor modulator chemical that is believed to affect hypothalamic ERα because of the evidence that the treatment of clomiphene citrate increases pulse frequency of LH, which implies enhancement of pulsatile secretion of GnRH by the hypothalamus (25). However, the molecular mechanism behind clomiphene’s effect on LH secretion regulation is still not fully understood. By increasing our knowledge of pituitary and hypothalamic ERα functionality, it might be possible to find more effective and safer selective estrogen receptor modulator chemicals for treatment of anovulatory infertile women or PCOS patients.

Differential profiles of LH pulse secretion in males and females had been previously reported (26–28). In adult men, unvarying pulse secretion of LH is observed approximately every 2 h (27). Additionally, male-specific episodic LH secretion is connected to the regulation of testosterone synthesis in the rodent testis (29–31). In women, the pattern of LH pulses changes during the ovulatory menstrual cycle. The pulse frequency increases gradually during the follicular phase, and amplitude is also increased during the midcycle ovulatory LH surge (28). Following ovulation, LH pulse frequency slows because of the feedback effect of E2. LH pulse frequency and amplitude were lower in PitERtgKO females than in ERαKO females. In addition, several PitERtgKO females did not show LH secretion during the detection period; this profile was not observed in ERαKO females. This result suggests the possibility that the secretion of LH in PitERtgKO females was similar to the male episodic LH secretion profile. Ectopic ovarian expression of LH early-responsive genes in the PitERtgKO supports this hypothesis. Namely, the LH-mediated expression of those genes is transient in the WT ovary; the mRNAs are not retained past 4 h in the LH (hCG)-treated WT ovary (19). It is likely that those genes are continuously activated by LH-mediated signaling in the PitERtgKO ovary. It is important to note that ectopic expression of those genes was not observed in the ERαKO ovary, suggesting that continuous exposure to high LH does not induce those genes. Our observations also imply that hypothalamic ERα-mediated signaling, such as GnRH secretion regulation, is necessary to ensure the accurate secretion of LH in cycling females.

Production of testosterone in the male is regulated by LH in testicular Leydig cells (32). On the other hand, it has previously been reported that ectopic Hsd17b3 expression in the PitERtgKO mouse ovary was observed in the theca/interstitial cells (33). The treatment of GnRH antagonist to the PitERtgKO and ERαKO females blocked the aberrant expression of Hsd17b3 and reduced serum testosterone levels, suggesting that the aberrant ovarian Hsd17b3 expression in the PitERtgKO mice is also regulated by LH in theca cells. Although the steady state level of serum LH was reduced in PitERtgKO females, Hsd17b3 expression remained. This result suggests that the intermittent LH secretion may be more important than the continuously high serum LH level in regulation of Hsd17b3 expression in the PitERtgKO mouse ovary. Surprisingly, we found a higher expression level of Hsd17b3 in the intermittent hCG-treated WT ovary compared with the vehicle-treated WT ovary. This result supports our hypothesis that intermittent LH secretion affects Hsd17b3 expression in the ovary. Importantly, this phenomenon occurred in the WT mouse ovary, suggesting that it is not a specific event to the PitERtgKO mouse ovary. Additionally, we observed the expression of Hsd3b6, a gene of testicular Hsd3b subtype, in the intermittent hCG-treated WT ovary in conjunction with higher testosterone levels when compared with the vehicle-treated mice. However, it was noticed that the testosterone levels of the hCG-treated group were distributed in the normal range of intact WT females. These results suggest that sporadic LH secretion in females may induce a higher testosterone state in the ovary, linked with the expression of testis-predominant HSDs. It has been previously reported that 5α-dihydrotestosterone treatment to the rodent generated PCOS-like phenotypes, such as disturbing the estrous cycle and obesity (34, 35). Recently, Ma et al. (36) reported that the theca cell–specific androgen receptor (AR) KO mice show a reduced response to excess 5α-dihydrotestosterone and lack PCOS-like phenotypes. This suggests that the overproduced testosterone in theca cells could affect the estrous cycle through AR in theca cells. We have previously reported the possible role of ERα involving intraovarian estrogen signaling for regulating expression of steroidogenic enzyme genes using the αERKO and global ERβ KO mice (3, 37, 38). Similar phenotypes have been subsequently reported using an ovarian theca cell–specific ERα KO mouse, showing modest elevation of serum testosterone and the presence of hemorrhagic cystic ovaries (39), supporting our hypothesis. PitERtgKO females do not possess ERα in the ovary, which might explain the higher anomalous production of testosterone in their ovaries. Taken together, these observations suggest the possibility that long-term anomalous LH secretion may enhance testosterone production locally and affect theca cell AR functionality to disturb female cyclicity. We have previously reported that the serum follicle-stimulating hormone (FSH) level was not affected in the αERKO female mice (40). Additionally, we observed that the FSH level was not different between PitERtgKO and ERαKO females (unpublished data). However, it might be necessary to know for future study that the effect of FSH upon sporadic LH secretion profile related atypical testosterone synthesis in ovary.

Our study proposes herein that an anomalous sporadic LH secretion profile could enhance a higher testosterone state. Because of the association of increased testosterone levels with PCOS, it poses a question as to whether the increased testosterone could be a cause of the cystic and hemorrhagic ovarian phenotype. In this aspect, it is important to note that the ovarian phenotype of ERαKO females was consistently milder than that seen in PitERtgKO females even though the serum testosterone level was the same. This suggests that the anomalous sporadic LH secretion affected 2 distinct ovarian events in parallel: steroid synthesis and follicular growth. Furthermore, we observed a steady-state expression of inflammation-related genes, such as ptgs2 (Cox-2) in the PitERtgKO ovary that is different from the transient expression of Ptgs2 in normal follicular growth (19). It is unlikely that the higher testosterone level is the sole cause of hemorrhagic cystic ovaries.

Our observations using a PitERtgKO mouse provide new insights into the role of pituitary ERα in HPG feedback regulation, which were not found in pituitary-specific ERα KO mouse models (7, 8). The new mouse line, Esr1+/−-Rosa26lslESR1/lslESR1, can be utilized to analyze the tissue-specific ERα functionality when crossed with the tissue-specific promoter fused Cre-possessing Esr1+/− mouse; this is especially helpful for analyzing phenotypes that cannot be seen in tissue-specific ERα KO models like we showed in this report.

Supplementary Material

This article includes supplemental data. Please visit http://www.fasebj.org to obtain this information.

Click here for additional data file. (65.1MB, tif)

ACKNOWLEDGMENTS

The authors thank David Monroy and the U.S. National Institutes of Health (NIH) National Institute of Environmental Health Sciences (NIEHS) Comparative Medicine Branch staff for animal care, the staff of the NIEHS Histology Core for histology, and Dr. Janet Hall and Dr. Natalie Shaw (NIEHS, Clinical Research Unit) for critical comments on this study. This study was supported by NIH NIEHS Grant 1ZIAES070065 (to K.S.K.) from the Division of Intramural Research of the NIEHS. The authors declare no conflicts of interest.

Glossary

αERKO

global ERα KO

AR

androgen receptor

Cga-cre

choriogonadotropin α subunit promoter fused cre

Cyp19

aromatase

E2

estradiol

EB

E2-benzoate

ERα

estrogen receptor α

FSH

follicle-stimulating hormone

hCG

human chorionic gonadotropin

HPG

hypothalamic-pituitary-gonadal

HSD

hydroxysteroid dehydrogenase

KO

knockout

Ovx

ovariectomized

PitERα KO

pituitary-specific ERα KO

PitERtgKO

pituitary-only ERα expressing

PCOS

polycystic ovary syndrome

Tg

transgenic

WT

wild type

Footnotes

This article includes supplemental data. Please visit http://www.fasebj.org to obtain this information.

AUTHOR CONTRIBUTIONS

Y. Arao, K. J. Hamilton, and K. S. Korach designed research studies; Y. Arao and K. J. Hamilton conducted experiments, acquired and analyzed data; S.-P. Wu, M.-J. Tsai, and F. J. DeMayo provided the key mutant mouse for study; and Y. Arao, K. J. Hamilton, and K. S. Korach wrote the manuscript.

REFERENCES

  • 1.Azziz R., Carmina E., Chen Z., Dunaif A., Laven J. S. E., Legro R. S., Lizneva D., Natterson-Horowtiz B., Teede H. J., Yildiz B. O. (2016) Polycystic ovary syndrome. Nat. Rev. Dis. Primers 2, 16057 [DOI] [PubMed] [Google Scholar]
  • 2.Wintermantel T. M., Campbell R. E., Porteous R., Bock D., Gröne H.-J., Todman M. G., Korach K. S., Greiner E., Pérez C. A., Schütz G., Herbison A. E. (2006) Definition of estrogen receptor pathway critical for estrogen positive feedback to gonadotropin-releasing hormone neurons and fertility. Neuron 52, 271–280 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Couse J. F., Yates M. M., Walker V. R., Korach K. S. (2003) Characterization of the hypothalamic-pituitary-gonadal axis in estrogen receptor (ER) null mice reveals hypergonadism and endocrine sex reversal in females lacking ERalpha but not ERbeta. Mol. Endocrinol. 17, 1039–1053 [DOI] [PubMed] [Google Scholar]
  • 4.Lubahn D. B., Moyer J. S., Golding T. S., Couse J. F., Korach K. S., Smithies O. (1993) Alteration of reproductive function but not prenatal sexual development after insertional disruption of the mouse estrogen receptor gene. Proc. Natl. Acad. Sci. USA 90, 11162–11166 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Risma K. A., Clay C. M., Nett T. M., Wagner T., Yun J., Nilson J. H. (1995) Targeted overexpression of luteinizing hormone in transgenic mice leads to infertility, polycystic ovaries, and ovarian tumors. Proc. Natl. Acad. Sci. USA 92, 1322–1326 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Couse J. F., Yates M. M., Sanford R., Nyska A., Nilson J. H., Korach K. S. (2004) Formation of cystic ovarian follicles associated with elevated luteinizing hormone requires estrogen receptor-beta. Endocrinology 145, 4693–4702 [DOI] [PubMed] [Google Scholar]
  • 7.Gieske M. C., Kim H. J., Legan S. J., Koo Y., Krust A., Chambon P., Ko C. (2008) Pituitary gonadotroph estrogen receptor-α is necessary for fertility in females. Endocrinology 149, 20–27 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Singh S. P., Wolfe A., Ng Y., DiVall S. A., Buggs C., Levine J. E., Wondisford F. E., Radovick S. (2009) Impaired estrogen feedback and infertility in female mice with pituitary-specific deletion of estrogen receptor alpha (ESR1). Biol. Reprod. 81, 488–496 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Cheong R. Y., Porteous R., Chambon P., Abrahám I., Herbison A. E. (2014) Effects of neuron-specific estrogen receptor (ER) α and ERβ deletion on the acute estrogen negative feedback mechanism in adult female mice. Endocrinology 155, 1418–1427 [DOI] [PubMed] [Google Scholar]
  • 10.Hewitt S. C., Kissling G. E., Fieselman K. E., Jayes F. L., Gerrish K. E., Korach K. S. (2010) Biological and biochemical consequences of global deletion of exon 3 from the ER alpha gene. FASEB J. 24, 4660–4667 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Xu P., Cao X., He Y., Zhu L., Yang Y., Saito K., Wang C., Yan X., Hinton A. O., Jr., Zou F., Ding H., Xia Y., Yan C., Shu G., Wu S.-P., Yang B., Feng Y., Clegg D. J., DeMarchi R., Khan S. A., Tsai S. Y., DeMayo F. J., Wu Q., Tong Q., Xu Y. (2015) Estrogen receptor-α in medial amygdala neurons regulates body weight. J. Clin. Invest. 125, 2861–2876 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Wu S.-P., Lee D.-K., Demayo F. J., Tsai S. Y., Tsai M.-J. (2010) Generation of ES cells for conditional expression of nuclear receptors and coregulators in vivo. Mol. Endocrinol. 24, 1297–1304 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Cushman L. J., Burrows H. L., Seasholtz A. F., Lewandoski M., Muzyczka N., Camper S. A. (2000) Cre-mediated recombination in the pituitary gland. Genesis 28, 167–174 [DOI] [PubMed] [Google Scholar]
  • 14.Arao Y., Hamilton K. J., Lierz S. L., Korach K. S. (2018) N-terminal transactivation function, AF-1, of estrogen receptor alpha controls obesity through enhancement of energy expenditure. Mol. Metab. 18, 68–78 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Pfaffl M. W. (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, e45 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Abatan O. I., Welch K. B., Nemzek J. A. (2008) Evaluation of saphenous venipuncture and modified tail-clip blood collection in mice. J. Am. Assoc. Lab. Anim. Sci. 47, 8–15 [PMC free article] [PubMed] [Google Scholar]
  • 17.Pérez-Millán M. I., Zeidler M. G., Saunders T. L., Camper S. A., Davis S. W. (2013) Efficient, specific, developmentally appropriate cre-mediated recombination in anterior pituitary gonadotropes and thyrotropes. Genesis 51, 785–792 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Uhlenhaut N. H., Jakob S., Anlag K., Eisenberger T., Sekido R., Kress J., Treier A.-C., Klugmann C., Klasen C., Holter N. I., Riethmacher D., Schütz G., Cooney A. J., Lovell-Badge R., Treier M. (2009) Somatic sex reprogramming of adult ovaries to testes by FOXL2 ablation. Cell 139, 1130–1142 [DOI] [PubMed] [Google Scholar]
  • 19.Couse J. F., Yates M. M., Deroo B. J., Korach K. S. (2005) Estrogen receptor-beta is critical to granulosa cell differentiation and the ovulatory response to gonadotropins. Endocrinology 146, 3247–3262 [DOI] [PubMed] [Google Scholar]
  • 20.Hakkarainen J., Jokela H., Pakarinen P., Heikelä H., Kätkänaho L., Vandenput L., Ohlsson C., Zhang F. P., Poutanen M. (2015) Hydroxysteroid (17β)-dehydrogenase 1-deficient female mice present with normal puberty onset but are severely subfertile due to a defect in luteinization and progesterone production. FASEB J. 29, 3806–3816 [DOI] [PubMed] [Google Scholar]
  • 21.Lin H., Hu G.-X., Dong L., Dong Q., Mukai M., Chen B.-B., Holsberger D. R., Sottas C. M., Cooke P. S., Lian Q.-Q., Li X.-K., Ge R.-S. (2009) Increased proliferation but decreased steroidogenic capacity in Leydig cells from mice lacking cyclin-dependent kinase inhibitor 1B. Biol. Reprod. 80, 1232–1238 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Kanasaki H., Bedecarrats G. Y., Kam K.-Y., Xu S., Kaiser U. B. (2005) Gonadotropin-releasing hormone pulse frequency-dependent activation of extracellular signal-regulated kinase pathways in perifused LbetaT2 cells. Endocrinology 146, 5503–5513 [DOI] [PubMed] [Google Scholar]
  • 23.Shaw N. D., Histed S. N., Srouji S. S., Yang J., Lee H., Hall J. E. (2010) Estrogen negative feedback on gonadotropin secretion: evidence for a direct pituitary effect in women. J. Clin. Endocrinol. Metab. 95, 1955–1961 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Moskovic D. J., Katz D. J., Akhavan A., Park K., Mulhall J. P. (2012) Clomiphene citrate is safe and effective for long-term management of hypogonadism. BJU Int. 110, 1524–1528 [DOI] [PubMed] [Google Scholar]
  • 25.Sir T., Alba F., Devoto L., Rossmanith W. (1989) Clomiphene citrate and LH pulsatility in PCO syndrome. Horm. Metab. Res. 21, 583 [DOI] [PubMed] [Google Scholar]
  • 26.Marshall J. C., Dalkin A. C., Haisenleder D. J., Griffin M. L., Kelch R. P. (1993) GnRH pulses--the regulators of human reproduction. Trans. Am. Clin. Climatol. Assoc. 104, 31–46 [PMC free article] [PubMed] [Google Scholar]
  • 27.Marshall J. C., Kelch R. P. (1986) Gonadotropin-releasing hormone: role of pulsatile secretion in the regulation of reproduction. N. Engl. J. Med. 315, 1459–1468 [DOI] [PubMed] [Google Scholar]
  • 28.Reame N., Sauder S. E., Kelch R. P., Marshall J. C. (1984) Pulsatile gonadotropin secretion during the human menstrual cycle: evidence for altered frequency of gonadotropin-releasing hormone secretion. J. Clin. Endocrinol. Metab. 59, 328–337 [DOI] [PubMed] [Google Scholar]
  • 29.Ellis G. B., Desjardins C. (1982) Male rats secrete luteinizing hormone and testosterone episodically. Endocrinology 110, 1618–1627 [DOI] [PubMed] [Google Scholar]
  • 30.Coquelin A., Desjardins C. (1982) Luteinizing hormone and testosterone secretion in young and old male mice. Am. J. Physiol. 243, E257–E263 [DOI] [PubMed] [Google Scholar]
  • 31.Södersten P., Eneroth P., Pettersson A. (1983) Episodic secretion of luteinizing hormone and androgen in male rats. J. Endocrinol. 97, 145–153 [DOI] [PubMed] [Google Scholar]
  • 32.Amory J. K., Bremner W. J. (2003) Regulation of testicular function in men: implications for male hormonal contraceptive development. J. Steroid Biochem. Mol. Biol. 85, 357–361 [DOI] [PubMed] [Google Scholar]
  • 33.Couse J. F., Yates M. M., Rodriguez K. F., Johnson J. A., Poirier D., Korach K. S. (2006) The intraovarian actions of estrogen receptor-α are necessary to repress the formation of morphological and functional Leydig-like cells in the female gonad. Endocrinology 147, 3666–3678 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Van Houten E. L. A. F., Kramer P., McLuskey A., Karels B., Themmen A. P. N., Visser J. A. (2012) Reproductive and metabolic phenotype of a mouse model of PCOS. Endocrinology 153, 2861–2869 [DOI] [PubMed] [Google Scholar]
  • 35.Caldwell A. S. L., Middleton L. J., Jimenez M., Desai R., McMahon A. C., Allan C. M., Handelsman D. J., Walters K. A. (2014) Characterization of reproductive, metabolic, and endocrine features of polycystic ovary syndrome in female hyperandrogenic mouse models. Endocrinology 155, 3146–3159 [DOI] [PubMed] [Google Scholar]
  • 36.Ma Y., Andrisse S., Chen Y., Childress S., Xue P., Wang Z., Jones D., Ko C., Divall S., Wu S. (2017) Androgen receptor in the ovary theca cells plays a critical role in androgen-induced reproductive dysfunction. Endocrinology 158, 98–108 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Couse J. F., Bunch D. O., Lindzey J., Schomberg D. W., Korach K. S. (1999) Prevention of the polycystic ovarian phenotype and characterization of ovulatory capacity in the estrogen receptor-alpha knockout mouse. Endocrinology 140, 5855–5865 [DOI] [PubMed] [Google Scholar]
  • 38.Taniguchi F., Couse J. F., Rodriguez K. F., Emmen J. M. A., Poirier D., Korach K. S. (2007) Estrogen receptor-α mediates an intraovarian negative feedback loop on thecal cell steroidogenesis via modulation of Cyp17a1 (cytochrome P450, steroid 17α-hydroxylase/17,20 lyase) expression. FASEB J. 21, 586–595 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Lee S., Kang D.-W., Hudgins-Spivey S., Krust A., Lee E.-Y., Koo Y., Cheon Y., Gye M. C., Chambon P., Ko C. (2009) Theca-specific estrogen receptor-alpha knockout mice lose fertility prematurely. Endocrinology 150, 3855–3862 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Couse J. F., Korach K. S. (1999) Estrogen receptor null mice: what have we learned and where will they lead us? Endocr. Rev. 20, 358–417 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Click here for additional data file. (65.1MB, tif)

Articles from The FASEB Journal are provided here courtesy of The Federation of American Societies for Experimental Biology

RESOURCES