Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | ActinGreen-488 | Molecular probes | R37110 | Manufacturer instructions |
| Antibody | ActinRed-555 | Molecular probes | R37112 | Manufacturer instructions |
| Antibody | AKAP-Lbc (VO96) | Diviani et al., 2001 | rabbit polyclonal | (1:1000) |
| Antibody | Amersham ECL Mouse IgG, HRP-linked F(ab')₂ fragment (from sheep) | GE Life Sciences | NA9310 | (1:10000) |
| Antibody | Amersham ECL Rabbit IgG, HRP-linked F(ab')₂ fragment (from donkey) | GE Life Sciences | NA9340 | (1:10000) |
| Antibody | Actin beta | Sigma-Aldrich | A1978 mouse monoclonal RRID:AB_476692 |
(1:2500) |
| Antibody | BrdU | Dako | M0744 mouse monoclonal RRID:AB_10013660 |
(1:1000) |
| Antibody | Donkey anti-Mouse IgG, Alexa Fluor 555 | Invitrogen | A-31570 | (1:500) |
| Antibody | Donkey anti-Mouse IgG, Alexa Fluor 488 | Invitrogen | A-21202 | (1:800) |
| Antibody | Donkey anti-Rabbit IgG, Alexa Fluor 488 | Invitrogen | R37118 | (1:500) |
| Antibody | Donkey anti-Rabbit IgG, Alexa Fluor 555 |
Invitrogen | A-31572 | (1:800) |
| Antibody | GAPDH-HRP | Novus | NB110-40405 mouse monoclonal RRID:AB_669249 |
(1:1000) |
| Antibody | Hsp70 | Proteintech | 10995–1 rabbit polyclonal RRID:AB_2264230 |
WB (1:500), PLA in tissue (1:200), PLA in cells (1:500) |
| Antibody | p-44/42 ERK | CST | 9102 rabbit polyclonal RRID:AB_330744 |
(1:1000) |
| Antibody | p-44/42 ERK | BD Transduction | 610123 mouse monoclonal RRID:AB_397529 |
WB (1:1000), IHC (1:100) |
| Antibody | phospho-p44/42 MAPK | CST | 9101 rabbit polyclonal RRID:AB_331646 |
WB (1:500), IHC (1:100) |
| Antibody | PKAc | BD Transduction | 610981 mouse monoclonal RRID:AB_398294 |
WB (1:500), PLA in tissue (1:200), PLA in cells (1:500) |
| Antibody | PKAc | CST | 5842 rabbit monoclonal RRID:AB_10706172 |
IHC (1:500) |
| Antibody | RIa | BD Transduction | 610610 mouse monoclonal RRID:AB_397944 |
(1:1000) |
| Antibody | RIIa | BD Transduction | 612243 mouse monoclonal RRID:AB_399566 |
(1:1000) |
| Antibody | RIIb | BD Transduction | 610626 mouse monoclonal RRID:AB_397958 |
(1:1000) |
| Antibody | phospho-RSK | Thermo-Fisher | PA5-37829 rabbit polyclonal RRID:AB_2554437 |
WB (1:500), IHC (1:100) |
| Antibody | FLAG M2 Magnetic Beads | Sigma-Aldrich | M8823 mouse monoclonal RRID:AB_2637089 |
IP (1:40) |
| Antibody | GFP | Rockland | 600-101-215 goat polyclonal RRID:AB_218182 |
WB (1:1000), IP (1:700) |
| Antibody | RI | BD Transduction | 610165 mouse monoclonal RRID:AB_397566 |
(1:500) |
| Antibody | phospho-PKA substrates (RRXS*/T*) | CST | 9624 rabbit monoclonal RRID:AB_331817 |
(1:1000) |
| Antibody | NeutrAvidin-HRP | Thermo-Fisher | 31030 | (1:5000) |
| Antibody | RIIa and b | McCartney et al., 1995 | goat polyclonal | (1:200) |
| Cell line (M. musculus) | AML12 | ATCC | ATCC: CRL-2254 RRID:CVCL_0140 |
Obtained from KJR by way of Nelson Fausto lab (original ATCC depositor) |
| Chemical compound, drug | DAPI | Thermo-Fisher | 62248 | Manufacturer instructions |
| Chemical compound, drug | ATP, [γ−32P]- 3000 Ci/mmol 10mCi/ml EasyTide, 100 µCi | Perkin-Elmer | BLU502A100UC | |
| Chemical compound, drug | BrdU | Invitrogen | B23151 | |
| Chemical compound, drug | Cobimetinib | Sigma-Aldrich | ADV465749767 | |
| Chemical compound, drug | Trametinib | Sigma-Aldrich | ADV465749287 | |
| Chemical compound, drug | Dexamethasone | Sigma-Aldrich | D4902 | |
| Chemical compound, drug | DMEM/F-12 | Gibco | 11320033 | |
| Chemical compound, drug | Fetal Bovine Serum | Thermo-Fisher | A3382001 | |
| Chemical compound, drug | Gentamicin sulfate salt | Sigma-Aldrich | G1264 | |
| Chemical compound, drug | ITS Liquid Media Supplement | Sigma-Aldrich | I3146 | |
| Chemical compound, drug | Lipofectamine LTX with Plus Reagent | Thermo-Fisher | 15338100 | |
| Chemical compound, drug | Puromycin | Sigma-Aldrich | P8833 | |
| Chemical compound, drug | TransIT-LT1 Transfection Reagent | Mirus | MIR2300 | |
| Chemical compound, drug |
Trypsin-EDTA (0.25%), phenol red | Gibco | 25200056 | |
| Chemical compound, drug | Crystal Violet | Sigma | C3886 | |
| Chemical compound, drug | Ver-155008 | Sigma-Aldrich | 1134156-31-2 | |
| Commercial assay or kit |
CellTiter 96 AQueous One Solution Cell Proliferation Assay | Promega | G3582 | |
| Commercial assay or kit | CryoGrinder Kir | OPS Diagnostics | CG0801 | |
| Commercial assay or kit | Duolink In Situ Orange Starter Kit Mouse/Rabbit | Sigma-Aldrich | DUO92102 | |
| Commercial assay or kit | GeneJET Genomic DNA purification kit | Thermo | K0721 | |
| Commercial assay or kit | Pierce BCA Protein Assay Kit | Thermo | 23225 | |
| Commercial assay or kit | PowerUp SYBR Green Master Mix | Thermo-Fisher | A25741 | |
| Commercial assay or kit | Reverse Transcription Supermix | Bio-Rad | 1708840 | |
| Commercial assay or kit | RNeasy Mini Kit | Qiagen | 74106 | |
| Commercial assay or kit | SignaTECT cAMP-Dependent Protein Kinase (PKA) Assay System | Promega | V7480 | |
| Commercial assay or kit | Zero Blunt TOPO PCR Cloning Kit | Thermo-Fisher | 450245 | |
| Peptide, recombinant protein | RII-biotin | Carr et al., 1992 | ||
| Peptide, recombinant protein | PKI | Sigma-Aldrich | P7739 | |
| Recombinant DNA reagent | DNAJ-PKAc FLAG | This paper | In-house modified pDEST12.2 (N-terminal FLAG) | |
| Recombinant DNA reagent | DNAJ-PKAc H33Q FLAG | This paper | In-house modified pDEST12.2 (N-terminal FLAG) | |
| Recombinant DNA reagent | DNAJB1 FLAG | This paper | This paper | In-house modified pDEST12.2 with N-terminal FLAG; backbone from Invitrogen (discontinued) |
| Recombinant DNA reagent | AKAP-Lbc GFP | Clonetech; Diviani et al., 2001 | pEGFP-N1 (Clontech) backbone | |
| Recombinant DNA reagent | hSpCas9-gDnajb1-Prkaca-2A-Puro | This paper | RRID:Addgene_48138 | PX458 backbone; Dual U6-sgRNA cassettes |
| Sequenced-based reagent | Gipc1_F | This paper | PCR primers | GGGAAAGGACAAAAGGAACCC |
| Sequenced-based reagent | Gipc1_R | This paper | PCR primers | CAGGGCATTTGCACCCCATGCC |
| Sequenced-based reagent | Ddx39_F | This paper | PCR primers | CCGGGACTTTCTACTGAAGCC |
| Sequenced-based reagent | Ddx39_R | This paper | PCR primers | GAATGGCCTGGGGAATACAC |
| Sequenced-based reagent | Lphn1_F | This paper | PCR primers | ACCCCTTCCAGATGGAGAATGT |
| Sequenced-based reagent | Lphn1_R | This paper | PCR primers | TGGGCAAGCATCTATGGCAC |
| Sequenced-based reagent | Dnajb1_ex2_F | This paper | qPCR primers | GGGACCAGACCTCGAACAAC |
| Sequenced-based reagent | Dnajb1_ex2_R | This paper | qPCR primers | GGCTAATCCTGGCTGGATAGAT |
| Sequenced-based reagent | Prkaca_ex1_F | This paper | qPCR primers | AAGAAGGGCAGCGAGCAGGA |
| Sequenced-based reagent | Prkaca_ex1_R | This paper | qPCR primers | GCCGGTGCCAAGGGTCTTGAT |
| Sequenced-based reagent | Gapdh_F | This paper | qPCR primers | ATTTGGCCGTATTGGGCGCCT |
| Sequenced-based reagent | Gapdh_R | This paper | qPCR primers | CCCGGCCTTCTCCATGGTGG |
| Sequenced-based reagent | Dnaj-PKAc_F | This paper | qPCR primers | ACGAGATCAAGCGAGCCTAC |
| Sequenced-based reagent | Dnaj-PKAc_R | This paper | qPCR primers | TTCCCACTCTCCTTGTGCTT |
| Software, algorithm | GraphPad Prism | GraphPad Prism (https://graphpad.com) | ||
| Software, algorithm | ImageJ | ImageJ (http://imagej.nih.gov/ij/) | ||
| Software, algorithm | MaxQuant/Andromeda | https://www.maxquant.org/ | PMID: 19029910 | |
| Software, algorithm |
NetworKIN | http://networkin.info/ | PMID: 24874572 | |
| Software, algorithm |
Perseus | https://maxquant.net/perseus/ | PMID: 27348712 | |
| Software, algorithm | PhosphoSitePlus | https://www.phosphosite.org |