Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
List of primers used for Real time PCR.
| No. | Gene name | Sequence (5′→ 3′) |
| 1 | Human GAPDH forward | CGGATTTGGTCGTATTG |
| 2 | Human GAPDH reverse | GGAAGATGGTGATGGGA |
| 3 | Human CCR7 forward | GGTATGCCTGTGTCAAGATG |
| 4 | Human CCR7 reverse | GGTTGAGCAGGTAGGTATCG |
| 5 | Human IL6 forward | CAATGAGGAGACTTGCCTGG |
| 6 | Human IL6 reverse | TGGGTCAGGGGTGGTTATTG |
| 7 | Human Zbtb46 forward | AGAGTGCTGGTGATGCCTG |
| 8 | Human Zbtb46 reverse | ACAGGTCCGCATTTGAGTC |
