Table 2.
PCR Primers (5′→3′ direction) used in this study
| ID | Primers | Sequence and description |
|---|---|---|
| 1 | fw_SEA0027 |
attagacgtcTAGTCGCCGCAGTAGTGATG Cloning NSI from Synechococcus genome (AatII overhang) |
| 2 | rv_SEA0027 |
aatggatccACCCGGTAGGGATTTCG Cloning NSI from Synechococcus genome (BamHI overhang) |
| 3 | fw_pDF_s_iq_e_t2 |
CTGGCTTTGCTTCCAGATGT Cloning of pDF cassette containing Spr/Strr, LacIq, Ptrc, efe variants and two rrnB terminators |
| 4 | rv_pDF_s_iq_e_t2_EagI |
taaacggccgCTTTCAGCTAGCGTACCA Cloning of pDF cassette containing Spr/Strr, LacIq, Ptrc, efe variants and two rrnB terminators (Eagl overhang) |
| 5 | fw_seq_NSI_7942 |
TAGTCGCCGCAGTAGTGATG Sequencing and colony PCR |
| 6 | rv_seq_NSI_7942 |
CTCCAGCAAGCTAGCGATTT Sequencing and colony PCR |
| 7 | 75_pUC_Rev |
GCTCACTCATTAGGCACCCCAGG Sequencing and colony PCR |
| 8 | rv_seq_NSI_ins |
AGGGCCGTGATCTTGTCAT Sequencing and colony PCR |
Complementary regions are shown in capital letters and restriction sites are underlined