Table 1.
Indel | Gene | Location | GenBank no. | Position in UMD_3.1 | Indel Sequence | Confirmed? |
---|---|---|---|---|---|---|
1 N ins | FCGR2B | exon7 | rs381714237 | chr3:7930047 | G | 1 |
3 N ins | CENPE | exon58 | ss2137349053 | chr6:23018080 | AGA | 1 |
3 N del | CENPE | exon68 | – | chr6:23026632–23026634 | TAG | 3 |
3 N ins | CENPE | intron13 | rs385060942 | chr6:22983076 | GTT | 1 |
1 N ins | CENPE | intron13 | ss2137349051 | chr6:22983397 | T | 1 |
1 N del | CENPE | intron18 | rs384082187 | chr6:22989805 | A | 2 |
21 N ins | CENPE | intron24 | rs377812754 | chr6:22996564–22996573 | ACTTAAGTATATAACCTTAAC | 2 |
2 N del | CENPE | intron41 | rs453960300 | chr6:23018994–23018995 | CC | 1 |
1 N del | CENPE | intron49 | rs378415122 | chr6:23036105 | C | 1 |
4 N ins | CENPE | intron51 | ss2137349056 | chr6:23040582 | ACAC | 4 |
2 N del | RETSAT | 3’UTR | rs136527375 | chr11:49489416–49489417 | AA | 2 |
9 N ins | RETSAT | intron6 | rs134985825 | chr11:49485899 | ATTCTGGGG | 1 |
1 N ins | ACSBG2 | intron7 | rs377943075 | chr7:19476990 | G | 1 |
2 N ins | NFKB2 | 5′ regulatory region | – | chr26:22891203 | GG | 3 |
1 N del | TBC1D1 | intron1 | rs136639319 | chr6:58898979 | T | 1 |
1 N ins | NLK | intron1 | rs137724510 | chr19:20180649 | T | 2 |
2 N del | NLK | intron1 | rs379188781 | chr19:20189055–20189056 | AT | 1 |
1 N del | NLK | intron3 | rs135129224 | chr19:20264835 | A | 2 |
4 N del | NLK | intron3 | rs134444531 | chr19:20276109–20276112 | AAAA | 1 |
5 N del | MAP3K1 | intron16 | ss2137349058 | chr20:22365627–22365631 | CATTT | 1 |
6 N del | SLC30A2 | intron2 | ss2137349049 | chr2:127640012–127640017 | TTTTTG | 2 |
2 N ins | ANGPT1 | intron1 | ss2137349057 | chr14:59305051 | AT | 2 |
1 N ins | UGDH | intron7 | rs383327605 | chr6:60236955 | T | 2 |
1 N ins | UGDH | intron2 | ss2019489562 | chr6:60252782 | G | 1 |
Note: 1 indels were genotyped successfully; 2 indels were failed to genotype using MALDI-TOF MS; 3 indels were not polymorphic in current population; 4 primers of indel were failed to design