Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | mouse monoclonal ANTI-FLAG M2 Affinity Gel |
Millipore Sigma | Cat #:2220 | (coupled to beads) |
| Recombinant DNA reagent |
core Widom 601 (uppercase) and flanking DNA sequences (lowercase) |
Lowary and Widom, 1998 | 5’_gggatcctaatgaccaaggaaa gcatgattcttcacaccgagttcatcc cttatgtgatggaccctatacgcggc cgcccTGGAGAATCCCGGTGCC GAGGCCGCTCAATTGGTCGTA GacAGCTCTAGCACCGCTTAAA CGCACGTACGCGCTGTCCCCCG CGTTTTAACCGCCAAGGGGAT TACTCCCTAGTCTCCAGGCACG TGTCAGATATATACATCCTGtgcat gtattgaacagcgaccttgccggtgccag tcggatagtgttccgagctcccactctaga ggatccccgggtaccg_3’ |
|
| Sequence-based reagent |
primer: Cy5-0-601 | IDT | 5’/5Cy5/TGGAGAATCCCGGTGCC GAGGCCGCTCAAT |
|
| Sequence-based reagent |
primer: 601–80-FAM | IDT | 5’/56-FAM/cggtacccggggatcctcta gagtgggagc |
|
| Sequence-based reagent |
primer: 601–0-Cy5 | IDT | 5’/5Cy5/CAGGATGTATATATCTGAC ACGTGCCTGGA |
|
| Sequence-based reagent |
primer: FAM-80–601 | IDT | 5’/56-FAM/gggatcctaatgaccaagg aaagcatgatt |
|
| Peptide, recombinant protein (Saccharomyces cerevisiae) |
ScChd1118-1274 | McKnight et al., 2011 | from Saccharomyces cerevisiae | |
| Peptide, recombinant protein (Homo sapiens) |
HsSNF2h |
Yang et al., 2006
|
from Homo sapiens | |
| Peptide, recombinant protein (Drosophila melanogaster) |
DmACF | Actif Motif | Cat #:31509 | from Drosophila melanogaster |
| Peptide, recombinant protein (Xenopus laevis) |
XlHistone H2A | Luger et al., 1997 | from Xenopus laevis | |
| Peptide, recombinant protein (X. laevis) |
XlHistone H2A- E61A/E64A/D90A/ E92A ‘APM’ |
Girish et al., 2016
|
from Xenopus laevis | |
| Peptide, recombinant protein (X. laevis) |
XlHistone H2B | Luger et al., 1997 | from Xenopus laevis | |
| Peptide, recombinant protein (X. laevis) |
XlHistone H2B-S53C |
Kassabov et al., 2002
|
from Xenopus laevis | |
| Peptide, recombinant protein (X. laevis) |
XlHistone H3-C110A | Dechassa et al., 2010 | from Xenopus laevis | |
| Peptide, recombinant protein (X. laevis) |
XlHIistone H4 | Luger et al., 1997 | from Xenopus laevis | |
| Commercial assay or kit |
Thermo sequenase dye primer manual cycle sequencing kit |
Affymetrix | Cat #:79260 | |
| Chemical compound, drug |
NaCl | Fisher Scientific | Cat #:S641-500 | |
| Chemical compound, drug |
Trizma base | Sigma | Cat #:T1503-1KG | |
| Chemical compound, drug |
Boric Acid | Fisher Scientific | Cat #:A73-500 | |
| Chemical compound, drug |
MgCl2 | Fisher Scientific | Cat #:BP214-500 | |
| Chemical compound, drug |
EDTA | Thermo Fisher | Cat #:AM9260G | |
| Chemical compound, drug |
KCl | Fisher Scientific | Cat #:P217-500 | |
| Chemical compound, drug |
DTT | Sigma Aldrich | Cat #:D9779 | |
| Chemical compound, drug |
Sucrose | Fisher Scientific | Cat #:S5-500 | |
| Chemical compound, drug |
Nonidet P-40 | Fisher Scientific | Cat #:MP1RIST1315 | |
| Chemical compound, drug |
BSA | New England Biolabs | Cat #:B9000S | |
| Chemical compound, drug |
Salmon Sperm DNA |
Invitrogen | Cat #:15632–011 | |
| Chemical compound, drug |
40% acrylamide/bis solution 19:1 |
Bio-Rad | Cat #:1610144 | |
| Chemical compound, drug |
Urea | Sigma Aldrich | Cat #:U1250 | |
| Chemical compound, drug |
Acrylamide | Bio-Rad | Cat #:1610101 | |
| Chemical compound, drug |
Bis N,N’-Methylene-Bis- Acrylamide |
Bio-Rad | Cat #:1610201 | |
| Chemical compound, drug |
2-mercaptoethanol | Sigma Aldrich | Cat #:M6250 | |
| Chemical compound, drug |
4-Azidophenacyl bromide |
Sigma Aldrich | Cat #:A6057 | |
| Chemical compound, drug |
Phenol:Chloroform 5:1 | Sigma Aldrich | Cat #:P1944 | |
| Chemical compound, drug |
Adenosine triphosphate disodium salt hydrate |
Sigma Aldrich | Cat #:A1852 | |
| Chemical compound, drug |
dNTPs | Invitrogen | Cat #:10297–018 | |
| Other | Multipurpose Mini Spin Columns |
BioVision | Cat # 6572–50 | |
| Other | HisPrep FF 16/10 (Nickel affinity) |
GE | Cat # 28-9365-51 | |
| Other | HisTrap HP, 5 ml (Nickel affinity) |
GE | Cat # 17-5248-01 | |
| Other | HiTrap SP FF, 5 ml | GE | Cat # 17-5157-01 | |
| Other | HiTrap Q FF, 5 ml | GE | Cat # 17-5156-01 | |
| Other | HiLoad 16/600 Superdex 200, prep grade |
GE | Cat # 28-9893-35 | |
| Other | HiLoad 16/600 Superdex 75, prep grade |
GE | Cat # 28-9893-33 | |
| Other | HiPrep 26/10 Desalting |
GE | Cat # 17-5087-01 | |
| Other | HiPrep 16/10 Q FF | GE | Cat # 17-5190-01 | |
| Other | HiPrep 16/10 SP FF | GE | Cat # 17-5192-01 | |
| Software, algorithm |
ImageJ | imagej.nih.gov/ij/ | ||
| Software, algorithm |
Mathematica | Wolfram |