KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| N/A | ||
| Bacterial and Virus Strains | ||
| mouse CNR1 shRNA silencing Adenovirus (Ad-m-Cnr1-shRNA) | Vector Biolabs | shADV-255795 |
| Scramble shRNA with GFP Adenovirus (Ad-scramble-shRNA) | Vector Biolabs | 1122 |
| Biological Samples | ||
| N/A | ||
| Chemicals, Peptides, and Recombinant Proteins | ||
| DMEM high glucose, pyruvate | ThermoFisher Scientific | 11995065 |
| DMEM low glucose, pyruvate | ThermoFisher Scientific | 11885084 |
| DMEM, no glucose, no glutamine, no phenol red | ThermoFisher Scientific | A1443001 |
| Fetal Bovine Serum (FBS), certified, heat inactivated | ThermoFisher Scientific | 10082147 |
| Penicillin-Streptomycin (5,000 U/mL), 100× | ThermoFisher Scientific | 15070063 |
| L-Glutamine(200 mM) | ThermoFisher Scientific | 25030081 |
| Trypsin (0.25%) EDTA | ThermoFisher Scientific | 25200056 |
| PBS (phosphate buffered saline) | ThermoFisher Scientific | 10010 |
| Oxfenicine (4-Hydroxy-D-phenylglycine) | MilliporeSigma | 215333 |
| Triacsin C from Streptomyces sp. | MilliporeSigma | T4540 |
| 4-bromocrotonic acid | Santa Cruz Biotechnology | sc-486695 |
| MRI-2443 | (Martinez-Grau, 2015) | N/A |
| JD5037 | (Chorvat et al., 2012) | N/A |
| Rimonabant (SR141716) | NIDA Drug Supply Proqram | NOCD-082 |
| JMV2959 | MilliporeSigma | 345888 |
| PF-5190457 | MilliporeSigma | PZ0270 |
| (±) Propranolol hydrochloride | MilliporeSigma | P0884 |
| [2H31] Palmitic acid | Cambridge Isotope Laboratories, Inc. | DLM-215–1 |
| 1,2,3,4-[13C4] Octanoic acid | Cambridge Isotope Laboratories, Inc. | CLM-2721–0.25 |
| JZL 195 | Cayman CHEMICAL | 13668 |
| Hydrochloric acid (HCI) | Avantor - Macron Fine Chemicals | 2612–14 |
| Sucrose | MilliporeSigma | S7903 |
| Saccharin | MilliporeSigma | 109185 |
| Quinine hydrochloride dihydrate | MilliporeSigma | Q1125 |
| Capsaicin | MilliporeSigma | M2028 |
| Ensure | Abbott Nutrition Abbott Laboratories | 57231 |
| CCK octapeptide (CCK-8) | Tocris Bioscience | 1166 |
| p-hydroxymercuribenzoic acid (PHMB) | MilliporeSigma | 55540 |
| Aprotinin from bovine lung | MilliporeSigma | A1153 |
| Dimethylsulfoxide (DMSO) | ATCC | 4-X |
| QIAzol Lysis Reagent | QIAGEN | 79306 |
| DNase I DNase I, Amplification Grade | ThermoFisher Scientific | 18068015 |
| RNeasy Lipid Tissue Mini Kit | Qiagen | 74804 |
| iScript™ cDNA synthesiskit | BIO-RAD | 9207996 |
| Fast SYBR™ Green Master Mix | Applied Biosystems | 4385617 |
| Ethanol (ethyl alcohol, U.S.P. 200 proof, anhydrous) | The Warner Graham Company; product obtained through NIH Supply Center | 6505001050000 |
| UltraPureTM Agarose | ThermoFisher Scientific | 16500500 |
| Formalin solution, neutral buffered, 10% | MilliporeSigma | HT501128 |
| RNAscope® LS Multiplex TSA Buffer | Advanced Cell Diagnostics | 322809 |
| GreenGlo Safe DNA Dye | Denville Scientific, Inc. | CA3600 |
| TAE Buffer (Tris-acetate-EDTA) (50X) | ThermoFisher Scientific | B49 |
| DirectPCR Lysis Reagent (Mouse Tail) 100ml | Viagen Biotech | 102-T |
| Proteinase K Powder (≥30 U/mg) | ThermoFisher Scientific | 17916 |
| dNTP Mix(10 mM) | ThermoFisher Scientific | 18427013 |
| Taq DNA Polymerase, recombinant | ThermoFisher Scientific | 10342020 |
| Tween® 80 | MilliporeSigma | P1754–25ML |
| 0.9% Sodium chloride for injection, USP - 50ml | Hospira Inc., obtained through NIH Division of Veterinary Resources | N/A |
| Sodium hydroxide solution | MilliporeSigma | 72068–100ML |
| Bovine Serum Albumin (BSA) solution, 30% in saline, fatty acid free, aseptically filled | MilliporeSigma | A9205–50ML |
| D-(+)-Glucose solution | MilliporeSigma | G8769–100ML |
| Qctanoic acid | MilliporeSigma | W279900-SAMPLE-K |
| Palmitic acid | MilliporeSigma | P0500–25G |
| Palmitoyl-L-carnitine | MilliporeSigma | 61251–10MG |
| Myristoyl-L-carnitine | MilliporeSigma | 61367–10MG |
| Lauroyl-L-carnitine | MilliporeSigma | 39953–10MG |
| Octanoyl-L-Carnitine | MilliporeSigma | 50892–10MG |
| Hexanoyl-L-carnitine | MilliporeSigma | 07439–10MG |
| Anandamide-d4 (N-(2-Hydroxyethyl-1, 1, 2, 2-d4)-5Z, 8Z, 11Z, 14Z-eicosatetraenamide) | Tocris | 3717 |
| Chloroform, stabilized with amylene, Optima™, for HPLC and GC, Fisher Chemical | ThermoFisher Scientific | C297–4 |
| Methanol, Optima™ LC/MS Grade, Fisher Chemical | ThermoFisher Scientific | A456–4 |
| Water, Optima™ LC/MS Grade, Fisher Chemical | ThermoFisher Scientific | W6–4 |
| Boc-Ala-OH (Boc-L-Alanine) | MilliporeSigma | 15380–100G |
| Critical Commercial Assays | ||
| Ethanol assay kit | Abeam | ab65343 |
| Fatty acid oxidation complete assay kit | Abeam | ab222944 |
| Unacylated Ghrelin (mouse, rat) Express EIA Kit | Cayman CHEMICAL | 10008953 |
| Acylated Ghrelin (mouse, rat) Express EIA Kit | Cayman CHEMICAL | 10006307 |
| Mouse Leptin ELISA Kit | As One International, Inc. | KTE71186 |
| Mouse/Rat Corticosterone ELISA | Alpco | 55-CORMS-E01 |
| Neuropeptide Y (NPY) (Human, Rat, Mouse) - EIA Kit | Phoenix Pharmaceuticals, Inc. | EK-049–03 |
| ACTH (Rat, Mouse)-EIA Kit | Phoenix Pharmaceuticals, Inc. | EK-001–21 |
| RNAscope® Multiplex Fluorescent Kit v2 | Advanced Cell Diagnostics | 323100 |
| TSA Cy 3, Cy 5, TMR, Fluorescein Evaluation Kit | Perkin Elmer | NEL760001KT |
| Deposited Data | ||
| Experimental Models: Cell Lines | ||
| MGN3–1 ghrelinomacell line | (Iwakura et al., 2010) | N/A |
| Experimental Models: Organisms/Strains | ||
| C57BL/6J | The Jackson Laboratory | 000664 |
| Cnr1−/− | (Zimmer et al., 1999) | N/A |
| Ghrl−/− | (Sun et al., 2003) | N/A |
| Ghsr−/− | (Sun et al., 2004) | N/A |
| Mboat4−/− | Cyagen US Inc., This paper | N/A |
| Oligonucleotides | ||
| Mm_Acadvl_1_SG QuantiTect Primer Assay (Acadvl) | QIAGEN | QT00253127 |
| Mm_Hadhb_1_SG QuantiTect Primer Assay (Hadhb) | QIAGEN | QT01059968 |
| Mm Mboat4_va.1_SG QuantiTect Primer Assay (Mboat4) | QIAGEN | QT01562232 |
| Mm_MGI:930008_1_SG QuantiTect Primer Assay (Ghrl) | QIAGEN | QT00137536 |
| Mm_Rpl19_2_SG QuantiTect Primer Assay (Rpl19) | QIAGEN | QT01779218 |
| mouse cannabinoid receptor 1 (Cnr1) | GeneCopoeia | MQP091551 |
| RNAscope® Probe-Mm-Cnr1-C3 | Advanced Cell Diagnostics | 420721-C3 |
| RNAscope® Probe-Mm-Mboat4 | Advanced Cell Diagnostics | 415311 |
| RNAscope® Probe-Mm-Ghrl-C2 | Advanced Cell Diagnostics | 41 5301-C2 |
| Mboat4−/− mice wt forward primer ATCCAGAACCTGGTATCCTGTAATA | This paper | N/A |
| Mboat4−/− mice wt reverse primer GTCAATCCCACTGACTCACAACACAG | This paper | N/A |
| Mboat4−/− mice mutant forward primer GAGTTCCTTGTCAAATCTCCAAAGCC | This paper | N/A |
| Mboat4−/− mice mutant reverse primer GTCAATCCCACTGACTCACAACACAG | This paper | N/A |
| Cnr1−/− wild type/mutant forward primer GTACCATCACCACAGACCTCCTC | (Zimmer et al., 1999) | N/A |
| Cnr1−/− wild type reverse primer GGATTCAGAATCATGAAGCACTCCA | (Zimmer et al., 1999) | N/A |
| Cnr1−/− mutant reverse primer AAGAACGAGATCAGCAGCCTCTGTT | (Zimmer et al., 1999) | N/A |
| Ghrl−/− wt forward primer GCTCTGGATGGACATGGCC | (Sun et al., 2003) | N/A |
| Ghrl−/− wt reverse primer CTGCGCATGTCTGCTGCTCC | (Sun et al., 2003) | N/A |
| Ghrl−/− mutant forward primer GAGGCTGAAGTTCAGATGTGCGGCG | (Sun et al., 2003) | N/A |
| Ghrl−/− mutant reverse primer CCTCGAATCAGCAACGGCTTGCCG | (Sun et al., 2003) | N/A |
| Ghsr−/− wt forward primer TCTTCGTGGTGGGCATCTCG | (Sun et al., 2004) | N/A |
| Ghsr−/− wt reverse primer CTTCCTCCCGATGAGACTGT | (Sun et al., 2004) | N/A |
| Ghsr−/− mutant forward primer AGCGCATCGCCTTCTATCGC | (Sun et al., 2004) | N/A |
| Ghsr−/− mutant reverse primer GCTCGACTTTGTCCAGGCC | (Sun et al., 2004) | N/A |
| Recombinant DNA | ||
| mouse CNR1 shRNA silencing Adenovirus (Ad-m-Cnr1-shRNA) | Vector Biolabs | shADV-255795 |
| Scramble shRNA with GFP Adenovirus (Ad-scramble-shRNA) | Vector Biolabs | 1122 |
| Software and Algorithms | ||
| GraphPad Prism 7 | GraphPad Software | N/A |
| MassHunter Workstation Optimizer software | Agilent Technologies | N/A |
| Other | ||
| N/A | ||