Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer sequences used for PCR resequencing of the five SNP sites
| Gene | SNP | Chr | POS | Primer sequence | Sequencing direction |
|---|---|---|---|---|---|
| RGPD3 | rs62152530 | 2q12 | 107,073,501 | ACTAAACTGTAAAATCCCTA | Forward |
| IGSF3 | rs647711 | 1p13 | 117,122,288 | CCCTCCCAAGGACTGCC | Forward |
| SLC28A3 | rs10868138 | 9q21 | 86,917,301 | TGATATTAAACCTCCCCTCA | Reverse |
| USP40 | rs1048603 | 2q37 | 234,394,487 | ACGTGCTGCTGAGGACAC | Reverse |
| USP40 | rs838543 | 2q37 | 234,432,017 | AGCCCTTGCTCCCTGAACG | Forward |
