KEY RESOURCES TABLE

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Anti-Tubulin β3 (Tuj1)	Biolegend	Cat. # 801201
Anti-POU3F2	Cell Signaling Technology	Cat. # 12137
Anti-CTIP2	Abcam	Cat. # ab18465
Anti-phospho-histone H3 (pH3)	Millipore Sigma	Cat. # 06570
Anti-phosphorylated vimentin (pVim)	MBL	Cat. # D076-3
Anti-CUX1	Santa Cruz	Cat. # sc-13024
Anti-BrdU	Abcam	Cat. # ab6326
Anti-tdTomato	Takara	Cat. # 632496
Anti-tdTomato	Sicgen	Cat. # AB8181-200
Anti-PTBP1	ThermoFisher	Cat. # 32-4800
Bacterial and Virus Strains
Ad:Cre	Alvarez-Buylla Lab	Merkle et al., 2007
Chemicals, Peptides, and Recombinant Proteins
4-Hydroxytamoxifen (4-OHT)	Millipore Sigma	Cat. # H7904
5-Bromo-2′-deoxyuridine (BrdU)	Millipore Sigma	Cat. # B5002
Critical Commercial Assays
RNAscope 2.5 HD Assay — BROWN	Advanced Cell Diagnostics	Cat. # 322300
RNAscope Probe-Mm-Pnky	Advanced Cell Diagnostics	Cat. # 405551
Deposited Data
RNA-seq: Emx1-Cre cortex and cNSC cultures	This paper	GEO: GSE127987
Experimental Models: Organisms/Strains
Mouse: wild-type: C57BL/6J	The Jackson Laboratory	MGI: 3028467
Mouse: UBC-Cre-ERT2: Ndor1Tg(UBC-cre/ERT2)1Ejb	The Jackson Laboratory	Ruzankina et al., 2007
Mouse: Emx1Cre: Emx1tm1(cre)Krj	The Jackson Laboratory	Gorski et al., 2002
Mouse: Ai14: Gt(ROSA)26Sortm14(CAG-tdTomato)Hze	The Jackson Laboratory	Madisen et al., 2010
Mouse: E2a-Cre: Tg(EIIa-cre)C5379Lmgd	The Jackson Laboratory	Lakso et al., 1996
Mouse: PnkyF	This paper	N/A
Mouse: Pnkynull	This paper	N/A
Mouse: BACPnky	This paper	N/A
Oligonucleotides
qPCR: Rplp0 F: CCGATCTGCAGACACACACT	Ramos et al., 2013	N/A
qPCR: Rplp0 R: ACCCTGAAGTGCTCGACATC	Ramos et al., 2013	N/A
qPCR: Pnky F: TCTCCTTTCTCCGCCAGTAA	Ramos et al., 2015	N/A
qPCR: Pnky R: CACCGCTTCTTGTCAGTTCA	Ramos et al., 2015	N/A
qPCR: Pou3f2 F: ATGTGCAAGCTGAAGCCTTT	Bonvin et al., 2012	N/A
qPCR: Pou3f2 R: CTCACCACCTCCTTCTCCAG	Bonvin et al., 2012	N/A
qPCR: U1 F: ACGAAGGTGGTTTTCCCAG	Ramos et al., 2015	N/A
qPCR: U1 R: GTCCCCCACTACCACAAA	Ramos et al., 2015	N/A
qPCR: β-actin F: CTAAGGCCAACCGTGAAAAG	Ramos et al., 2015	N/A
qPCR: β-actin R: ACCAGAGGCATACAGGGACA	Ramos et al., 2015	N/A
Recombinant DNA
BAC containing the mouse Pnky locus	BACPAC Resources Center	Clone RP23-451I6
Software and Algorithms
Hisat2 v2.1.0	Kim et al., 2015	https://ccb.jhu.edu/software/hisat2/index.shtml
DESeq2	Love et al., 2014	https://bioconductor.org/packages/release/bioc/html/DESeq2.html
fdrtool	Strimmer, 2008	https://CRAN.R-project.org/package=fdrtool
Homer findMotifs.pl	Heinz et al., 2010	http://homer.ucsd.edu/homer/motif/
VAST-TOOLS v.1.0; VAST-TOOLS diff module	Braunschweig et al., 2014; Irimia et al., 2014; Han et al., 2017	https://github.com/vastgroup/vast-tools
Kallisto v0.43.1	Bray et al., 2016	https://github.com/pachterlab/kallisto/releases
Fiji / ImageJ	Schindelin et al., 2012	https://fiji.sc
Prism 7	GraphPad Software	N/A
Adobe Photoshop	Adobe Systems Inc.	N/A
Adobe Illustrator	Adobe Systems Inc.	N/A