Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Homo sapiens) | HaCaT cells | Cell Lines Services (CLS) | Cat. #: 300493; RRID:CVCL_0038 | human immortalized keratinocytes (from adult skin) |
| Cell line (Homo sapiens) | HeLa cells | German Resource Center of Biological Material (DSMZ) | Cat. #: ACC 57; RRID:CVCL_0030 | human cervical carcinoma cell line |
| Cell line (Homo sapiens) | NHEK cells | PromoCell | Cat. #: C-12002 | normal human epidermal keratinocytes |
| Antibody | anti-ADAM10 (rabbit polyclonal) | Merck Millipore | Cat. #: AB19026; RRID:AB_2242320 | WB (1:750) |
| Antibody | anti-ADAM17 (rabbit polyclonal) | Merck Millipore | Cat. #: AB19027; RRID:AB_91097 | WB (1:1000) |
| Antibody | anti-AREG (goat polyclonal) | R and D Systems | Cat. #: AF262; RRID:AB_2243124 | |
| Antibody | anti-CD151 (mouse monoclonal) | Bio-Rad | Bio-Rad: MCA1856; RRID:AB_2228964 | IHC (1:100) |
| Antibody | anti-EGFR (rabbit monoclonal) | Cell Signaling | Cat. #: 4267; RRID:AB_2246311 | IHC (1:100) |
| Antibody | anti-EGFR; Cetuximab | Merck | 3023710001 | |
| Antibody | anti-L1 K75 (rabbit polyclonall) | PMID: 15543569 | WB (1:10000); IHC (1:1000), flow cytometry (1:500) | |
| Antibody | anti-L1 16L1-312F (mouse monoclonal) | PMID: 17640876 | WB (1:350); IHC (1:10) | |
| Antibody | anti-L1 33L1-7 (mouse monoclonal) | PMID: 7996132 | WB (1:350) | |
| Antibody | anti-mouse Alexa Fluor 488 (goat polyclonal) | Molecular Probes (Invitrogen) | Cat. #: A-11029; RRID:AB_138404 | IHC (1:450) |
| Antibody | anti-mouse Alexa Fluor 546 (goat polyclonal) | Molecular Probes (Invitrogen) | Cat. #: A-11030; RRID:AB_144695 | IHC (1:450) |
| Antibody | anti-mouse Alexa Fluor 647 (donkey polyclonal) | Molecular Probes (Invitrogen) | Cat. #: A-31571; RRID:AB_162542 | IHC (1:200) |
| Antibody | anti-p44/42 MAPK (rabbit monoclonal) | Cell Signaling | Cat. #: 4695; RRID:AB_390779 | WB (1:2000) |
| Antibody | anti-p44/42 MAPK-Thr202, Tyr204 (rabbit monoclonal) | Cell Signaling | Cat. #: 4370; RRID:AB_2315112 | WB (1:2000) |
| Antibody | anti-rabbit Alexa Fluor 488 (goat polyclonal) | Molecular Probes (Invitrogen) | Cat. #: A-11034; RRID:AB_2576217 | IHC (1:450) |
| Antibody | anti-rabbit Alexa Fluor 546 (goat polyclonal) | Molecular Probes (Invitrogen) | Cat. #: A-11035; RRID:AB_143051 | IHC (1:450) |
| Antibody | anti-rabbit Alexa Fluor 594 (donkey polyclonal) | Molecular Probes (Invitrogen) | Cat. #: A-21207; RRID:AB_141637 | IHC (1:200) |
| Antibody | anti-TGFα (goat polyclonal) | R and D Systems | Cat. #: AF-239; RRID:AB_2201779 | |
| Antibody | anti-α-tubulin (mouse monoclonal) | Sigma-Aldrich | Cat. #: T5168; RRID:AB_477579 | WB (1:10000) |
| Antibody | anti-β-actin (mouse monoclonal) | Sigma-Aldrich | Cat. #: A5441; RRID:AB_476744 | WB (1:10000) |
| Antibody | control IgG (mouse) | Sigma-Aldrich | Cat. #: I5381; RRID:AB_1163670 | |
| Antibody | HRP anti-rabbit (polyclonal) | Jackson ImmunoResearch | Cat. #: 111-035-003; RRID:AB_231356 | WB (1:10000) |
| Antibody | HRP anti-mouse (polyclonal) | Jackson ImmunoResearch | Cat. #: 115-035-003; RRID:AB_10015289 | WB (1:10000) |
| Recombinant DNA reagent | AP-TGFα |
PMID: 17079736 |
provided by Dr. Carl P. Blobel (Hospital for Special Surgery, New York, USA) | |
| Recombinant DNA reagent | CD151-CFP | PMID: 23302890 | ||
| Recombinant DNA reagent | CD151-GFP | PMID: 23302890 | provided by Dr. Dr. Xin A. Zhang (Oklahoma City, USA) | |
| Sequenced-based reagent | siRNA (in this paper ADAM10 #1) | Sigma-Aldrich | sequence GGACAAACUUAACAACAAU | |
| Sequenced-based reagent | siRNA (in this paper ADAM10 #2) | Sigma-Aldrich | sequence UACACCAGUCAUCUGGUAUUUCCUC | |
| Sequenced-based reagent | siRNA (in this paper ADAM17 #1) | Invitrogen | sequence GGAAGCUGACCUGGUUACAACUCAU | |
| Sequenced-based reagent | siRNA (in this paper ADAM17 #2) | Invitrogen | sequence CCAGGGAGGGAAAUAUGUCAUGUAU | |
| Peptide, recombinant protein | EGF-Alexa Fluor 488 complex | Thermo Fischer Scientific | Cat. #: E13345 | |
| Peptide, recombinant protein | human ADAM17 | R and D Systems | Cat. #: 930-ADB | |
| Peptide, recombinant protein | human AREG | Peprotech | Cat. #: 100-55B | |
| Peptide, recombinant protein | human HB-EGF | Roche | Cat. #: 259-HE | |
| Peptide, recombinant protein | human TGFα | Biolegend | Cat. #: 589904 | |
| Commercial assay, kit | CytoTox-ONE Homogeneous Membrane Integrity Assay | Promega | Cat. #: G7890 | |
| Commercial assay, kit | DuolinkIn Situ Orange Starter Kit Mouse/Rabbit | Sigma-Aldrich | Cat. #: DUO92102 | |
| Commercial assay, kit |
Human Amphiregulin DuoSet ELISA kit | R and D Systems | Cat. #: DY262 | |
| Chemical compound | GI254023X | Tocris Bioscience | Cat. #: 3995 | |
| Chemical compound | GW280264X | Aobious | Cat. #: AOB3632 | |
| Chemical compound | TAPI-0 | Sigma-Aldrich | Cat. #: SML1292 | |
| Other | luciferase assay buffer | This paper | see Materials and methods | |
| Software, algorithm | ImageJ | ImageJ (http://imagej.nih.gov/ij/) | ||
| Software, algorithm | Statistical Software R (2017, version 3.3.3) | R (http://www.R-project.org/) | R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria |