Skip to main content
. 2019 May 20;8:e44345. doi: 10.7554/eLife.44345

Key resources table.

Reagent type
(species) or
resource
Designation Source or
reference
Identifiers Additional
information
Cell line (Homo sapiens) HaCaT cells Cell Lines Services (CLS) Cat. #: 300493; RRID:CVCL_0038 human immortalized keratinocytes (from adult skin)
Cell line (Homo sapiens) HeLa cells German Resource Center of Biological Material (DSMZ) Cat. #: ACC 57; RRID:CVCL_0030 human cervical carcinoma cell line
Cell line (Homo sapiens) NHEK cells PromoCell Cat. #: C-12002 normal human epidermal keratinocytes
Antibody anti-ADAM10 (rabbit polyclonal) Merck Millipore Cat. #: AB19026; RRID:AB_2242320 WB (1:750)
Antibody anti-ADAM17 (rabbit polyclonal) Merck Millipore Cat. #: AB19027; RRID:AB_91097 WB (1:1000)
Antibody anti-AREG (goat polyclonal) R and D Systems Cat. #: AF262; RRID:AB_2243124
Antibody anti-CD151 (mouse monoclonal) Bio-Rad Bio-Rad: MCA1856; RRID:AB_2228964 IHC (1:100)
Antibody anti-EGFR (rabbit monoclonal) Cell Signaling Cat. #: 4267; RRID:AB_2246311 IHC (1:100)
Antibody anti-EGFR; Cetuximab Merck 3023710001
Antibody anti-L1 K75 (rabbit polyclonall) PMID: 15543569 WB (1:10000); IHC (1:1000), flow cytometry (1:500)
Antibody anti-L1 16L1-312F (mouse monoclonal) PMID: 17640876 WB (1:350); IHC (1:10)
Antibody anti-L1 33L1-7 (mouse monoclonal) PMID: 7996132 WB (1:350)
Antibody anti-mouse Alexa Fluor 488 (goat polyclonal) Molecular Probes (Invitrogen) Cat. #: A-11029; RRID:AB_138404 IHC (1:450)
Antibody anti-mouse Alexa Fluor 546 (goat polyclonal) Molecular Probes (Invitrogen) Cat. #: A-11030; RRID:AB_144695 IHC (1:450)
Antibody anti-mouse Alexa Fluor 647 (donkey polyclonal) Molecular Probes (Invitrogen) Cat. #: A-31571; RRID:AB_162542 IHC (1:200)
Antibody anti-p44/42 MAPK (rabbit monoclonal) Cell Signaling Cat. #: 4695; RRID:AB_390779 WB (1:2000)
Antibody anti-p44/42 MAPK-Thr202, Tyr204 (rabbit monoclonal) Cell Signaling Cat. #: 4370; RRID:AB_2315112 WB (1:2000)
Antibody anti-rabbit Alexa Fluor 488 (goat polyclonal) Molecular Probes (Invitrogen) Cat. #: A-11034; RRID:AB_2576217 IHC (1:450)
Antibody anti-rabbit Alexa Fluor 546 (goat polyclonal) Molecular Probes (Invitrogen) Cat. #: A-11035; RRID:AB_143051 IHC (1:450)
Antibody anti-rabbit Alexa Fluor 594 (donkey polyclonal) Molecular Probes (Invitrogen) Cat. #: A-21207; RRID:AB_141637 IHC (1:200)
Antibody anti-TGFα (goat polyclonal) R and D Systems Cat. #: AF-239; RRID:AB_2201779
Antibody anti-α-tubulin (mouse monoclonal) Sigma-Aldrich Cat. #: T5168; RRID:AB_477579 WB (1:10000)
Antibody anti-β-actin (mouse monoclonal) Sigma-Aldrich Cat. #: A5441; RRID:AB_476744 WB (1:10000)
Antibody control IgG (mouse) Sigma-Aldrich Cat. #: I5381; RRID:AB_1163670
Antibody HRP anti-rabbit (polyclonal) Jackson ImmunoResearch Cat. #: 111-035-003; RRID:AB_231356 WB (1:10000)
Antibody HRP anti-mouse (polyclonal) Jackson ImmunoResearch Cat. #: 115-035-003; RRID:AB_10015289 WB (1:10000)
Recombinant DNA reagent AP-TGFα
PMID: 17079736
provided by Dr. Carl P. Blobel (Hospital for Special Surgery, New York, USA)
Recombinant DNA reagent CD151-CFP PMID: 23302890
Recombinant DNA reagent CD151-GFP PMID: 23302890 provided by Dr. Dr. Xin A. Zhang (Oklahoma City, USA)
Sequenced-based reagent siRNA (in this paper ADAM10 #1) Sigma-Aldrich sequence GGACAAACUUAACAACAAU
Sequenced-based reagent siRNA (in this paper ADAM10 #2) Sigma-Aldrich sequence UACACCAGUCAUCUGGUAUUUCCUC
Sequenced-based reagent siRNA (in this paper ADAM17 #1) Invitrogen sequence GGAAGCUGACCUGGUUACAACUCAU
Sequenced-based reagent siRNA (in this paper ADAM17 #2) Invitrogen sequence CCAGGGAGGGAAAUAUGUCAUGUAU
Peptide, recombinant protein EGF-Alexa Fluor 488 complex Thermo Fischer Scientific Cat. #: E13345
Peptide, recombinant protein human ADAM17 R and D Systems Cat. #: 930-ADB
Peptide, recombinant protein human AREG Peprotech Cat. #: 100-55B
Peptide, recombinant protein human HB-EGF Roche Cat. #: 259-HE
Peptide, recombinant protein human TGFα Biolegend Cat. #: 589904
Commercial assay, kit CytoTox-ONE Homogeneous Membrane Integrity Assay Promega Cat. #: G7890
Commercial assay, kit DuolinkIn Situ Orange Starter Kit Mouse/Rabbit Sigma-Aldrich Cat. #: DUO92102
Commercial
assay, kit
Human Amphiregulin DuoSet ELISA kit R and D Systems Cat. #: DY262
Chemical compound GI254023X Tocris Bioscience Cat. #: 3995
Chemical compound GW280264X Aobious Cat. #: AOB3632
Chemical compound TAPI-0 Sigma-Aldrich Cat. #: SML1292
Other luciferase assay buffer This paper see Materials and methods
Software, algorithm ImageJ ImageJ (http://imagej.nih.gov/ij/)
Software, algorithm Statistical Software R (2017, version 3.3.3) R (http://www.R-project.org/) R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria