Skip to main content
NCBI home page
3 Biotech logoLink to 3 Biotech
. 2019 Jun 11;9(7):262. doi: 10.1007/s13205-019-1785-6

Analysis of allelic variation in wild potato (Solanum) species by simple sequence repeat (SSR) markers

Jagesh Kumar Tiwari 1,✉, Nilofer Ali 1, Sapna Devi 1, Rasna Zinta 1, Vinod Kumar 1, Swarup Kumar Chakrabarti 1
PMCID: PMC6557950  PMID: 31192087

Abstract

Allelic variation in wild potato (Solanum) species was analysed using 14 simple sequence repeat (SSR) markers. SSR allelic profiles showed high polymorphism and distinctness among the wild species. A total of 109 alleles of 14 polymorphic SSR markers were scored in 82 accessions belonging to 22 wild potato species. Allele size ranged from a minimum of 104 bp (STI0030) to a maximum of 304 bp (STM5114). Number of SSR alleles per marker ranged from 4 (STM5127/STM1053) to 13 (STM0019), whereas PIC value varied between 0.66 (STM1053) and 0.91 (STM0019). Cluster analysis using SSR allelic profiles of 82 accessions grouped showed 5 major clusters (I–V) based on the Dice similarity coefficient using neighbour-joining clustering method. Distinct allelic variations were observed among the accessions irrespective of the origin country, series and species. Our study suggests that SSR-based molecular characterization of wild potato species is accession specific and development of an allelic dataset for all the accessions would strengthen their utilization in potato research in future.

Electronic supplementary material

The online version of this article (10.1007/s13205-019-1785-6) contains supplementary material, which is available to authorized users.

Keywords: Alleles, Diversity, Potato, SSR marker, Solanum species

Introduction

Potato (Solanum tuberosum L.) plays a key role in the global food and nutritional security after rice, wheat and maize (Chakrabarti et al. 2017). With increasing population and more food demand compounded with disease pests’ pressure and climate change, enhancing potato production is necessary through development of new varieties using diverse genetic resources like wild/semi and cultivated Solanum species in potato. Potato belongs to a diverse gene pool which includes more than 200 Solanum species possessing various desirable traits and biotic/abiotic stresses (Machida-Hirano and Niino 2017). A few potato species have been utilized in breeding (Bradshaw et al. 2006), pre-breeding and biotechnology like somatic fusion (Tiwari et al. 2018b) and still many more species need to be applied.

The potato (Solanum) species consist of diploids (73%), triploids (4%), tetraploids (15%), pentaploids (2%) and hexaploids (6%) (Gopal et al. 2003). The cultivated potato is Solanum tuberosum ssp. tuberosum (long-days adapted) and is found naturally in southern Chile, whereas Solanum tuberosum ssp. andigena (short-days adapted) is widely distributed in the Andean regions of Venezuela and northern Argentina (Gopal et al. 2003). Besides, primitive cultivated species are confined to the Andes of South America, which are S. phureja (2n = 2x = 24), S. chaucha (2n = 3x = 36), S. stenotomum (2n = 2x = 24), S. goniocalyx (2n = 2x = 24), S. curtilobum (2n = 5x = 60), S. juzepczukii (2n = 3x = 36) and S. ajanhuiri (2n = 2x = 24) (Machida-Hirano and Niino 2017). Wild species are adapted to stress environments such as frost (e.g. S. acaule), dry semi-desert (e.g. S. berthaultii), cool temperate (e.g. S. colombianum Dun.), and coastal plains (S. commersonii and S. chacoense). Wild species also possess resistance to various pests and diseases, for example, resistance to late blight—the most devastating disease of potato—has been introgressed into the cultivated types such as S. tuberosum subsp. andigena, and wild S. demissum, S. stoloniferum, S. phureja, S. chacoense, S. bulbocastanum as well as S. acaule in Europe and America (Bradshaw et al. 2006). In India, late blight resistance in the most popular potato cv. Kufri Jyoti was derived from wild S. demissum and now this variety is highly susceptible. Thus, there are several wild potato species which might be important for potato improvement in the future (Tiwari et al. 2017).

It is essential to characterize wild potato species before their deployment in improvement programmes using molecular markers for their diversity pattern, germplasm management and other similar studies. DNA markers have been used for a long time in potato characterization. Among them, simple sequence repeat (SSR) is an excellent marker system to study closely related genotypes due to co-dominance, locus specific, reproducibility and being capable of high-throughput genotyping (Provan et al. 1996; Powell et al. 1996). Earlier, several researchers have used SSR markers to investigate diversity in potato (Liao and Guo 2014; Tiwari et al. 2013, 2018a), development of potato genetic identity (PGI) kit of 24 SSR markers (Ghislain et al. 2009) and many others. Our aim in this study was to investigate allelic variations in wild potato (Solanum) species by SSR markers, analyse the molecular diversity and develop an SSR allelic dataset for their future application.

Materials and methods

Plant material

Eighty-two accessions belonging to 22 wild potato (Solanum) species were used in this study. Wild accessions were grown in the earthen pots (in triplicates) at Indian Council of Agricultural Research (ICAR)-Central Potato Research Institute (CPRI), Shimla, Himachal Pradesh, India. In vitro plants were raised from true potato seeds (TPS) and multiplied through tissue culture as described by Sarkar et al. (2011). A single mother plant per accession was clonally regenerated. TPS were obtained from the international gene banks namely Potato Introduction Station, NRSP-6, Sturgeon Bay, Wisconsin (USA); Centre for Genetic Resources, Wageningen University and Research, the Netherlands (CGN); and International Potato Centre, Lima, Peru. A brief description of the wild species is summarised in Table 1 and images are shown in Fig. 1.

Table 1.

Details of 82 accessions belonging to 22 wild potato (Solanum) species used in SSR analysis.

Scientific name of wild species along with ploidy/EBN/Chr. no. details are mentioned from the search US Gene bank search: https://npgsweb.ars-grin.gov; or CGN Gene bank search: https://cgngenis.wur.nl; or adapted from Hijmans and Spooner (2001). Nomenclature is based on Hawkes (1990)

S. no. Solanum species Origin country Genbank IDa Chr. no./Ploidy/EBN Series Lab codeb # Allelesc Cluster
1. Solanum acaule Bitter Bolivia PI 210029 48/4x/2 Acaulia ACL29 35 I
2. Solanum acaule Bitter subsp. aemulans Argentina CGN17938 48/4x/2 Acaulia ACL38 30 I
3. Solanum berthaultii Hawkes Bolivia PI 310925 24/2x/2 Tuberosa BER25 39 II
4. Solanum berthaultii Hawkes Bolivia PI 265857 24/2x/2 Tuberosa BER57 30 III
5. Solanum berthaultii Hawkes Bolivia PI 265858 24/2x/2 Tuberosa BER58 36 II
6. Solanum berthaultii Hawkes Bolivia PI 498096 24/2x/2 Tuberosa BER96 38 II
7. Solanum cardiophyllum Lindl. subsp. cardiophyllum Mexico CGN18325 24/2x/1 Pinnatisecta CPH25 37 I
8. Solanum cardiophyllum Lindl. subsp. cardiophyllum Mexico CGN18326 24/2x/1 Pinnatisecta CPH26 32 I
9. Solanum cardiophyllum Lindl. Mexico PI 283062 24/2x/1 Pinnatisecta CPH62 32 I
10. Solanum cardiophyllum Lindl. Mexico PI 283063 24/2x/1 Pinnatisecta CPH63 37 I
11. Solanum cardiophyllum Lindl. Mexico PI 595465 24/2x/1 Pinnatisecta CPH65 38 I
12. Solanum cardiophyllum Lindl. subsp. cardiophyllum Mexico CGN22387 24/2x/1 Pinnatisecta CPH87 33 I
13. Solanum chacoense Bitter Argentina PI 197760 24/2x/2 Yungasensa CHC60 38 I
14. Solanum chomatophilum Bitter Peru PI 310990 24/2x/2 Conicibaccata CHM90 35 I
15. Solanum hannemanii d Argentina CGN18001 24/2x/2 Tuberosa HAN01 31 I
16. Solanum hjertingii Hawkes Mexico PI 283103 48/4x/2 Longipedicellata HJT03 28 I
17. Solanum hougasii Correll Mexico PI 161727 72/6x/4 Demissa HOU27 38 II
18. Solanum huancabambense Ochoa Peru CGN18306 24/2x/2 Yungasensa HCB06 27 I
19. Solanum huancabambense Ochoa Peru CGN17719 24/2x/2 Yungasensa HCB19 35 I
20. Solanum iopetalum (Bitter) Hawkes Mexico PI 239402 72/6x/4 Demissa IOP02 46 II
21. Solanum iopetalum (Bitter) Hawkes Mexico PI 230459 72/6x/4 Demissa IOP59 35 II
22. Solanum iopetalum (Bitter) Hawkes Mexico PI 275180 72/6x/4 Demissa IOP80 44 II
23. Solanum jamesii Torr. United States of America PI 498407 24/2x/1 Pinnatisecta JAM07 33 III
24. Solanum jamesii Torr. United States of America CGN18346 24/2x/1 Pinnatisecta JAM46 36 I
25. Solanum jamesii Torr. United States of America CGN18349 24/2x/1 Pinnatisecta JAM49 39 III
26. Solanum jamesii Torr. United States of America CIP762777 24/2x/1 Pinnatisecta JAM77 47 III
27. Solanum jamesii Torr. United States of America PI 558089 24/2x/1 Pinnatisecta JAM89 42 III
28. Solanum lesteri Hawkes & Hjert. Mexico CGN24429 24/2x/1 Polyadenia LES29 32 V
29. Solanum lesteri Hawkes & Hjert. Mexico PI 558434 24/2x/1 Polyadenia LES34 35 V
30. Solanum lesteri Hawkes & Hjert. Mexico CGN18337 24/2x/1 Polyadenia LES37 44 V
31. Solanum lesteri Hawkes & Hjert. Mexico CGN23988 24/2x/1 Polyadenia LES88 32 V
32. Solanum medians Bitter Peru PI 283081 24/2x/2 Tuberosa MED81 39 I
33. Solanum microdontum Bitter Argentina PI 218224 24/2x/2 Tuberosa MCD24 27 I
34. Solanum microdontum Bitter Argentina PI 473171 24/2x/2 Tuberosa MCD71 30 I
35. Solanum microdontum Bitter Argentina PI 195185 24/2x/2 Tuberosa MCD85 42 I
36. Solanum pinnatisectum Dunal Mexico CGN23011 24/2x/1 Pinnatisecta PNT11 46 III
37. Solanum pinnatisectum Dunal Mexico CGN23012 24/2x/1 Pinnatisecta PNT12 40 III
38. Solanum pinnatisectum Dunal Mexico CGN18331 24/2x/1 Pinnatisecta PNT31 48 III
39. Solanum pinnatisectum Dunal Mexico CGN17740 24/2x/1 Pinnatisecta PNT40 47 III
40. Solanum pinnatisectum Dunal Mexico CGN17741 24/2x/1 Pinnatisecta PNT41 49 III
41. Solanum pinnatisectum Dunal Mexico CGN17442 24/2x/1 Pinnatisecta PNT42 33 I
42. Solanum pinnatisectum Dunal Mexico CGN17443 24/2x/1 Pinnatisecta PNT43 35 I
43. Solanum pinnatisectum Dunal Mexico CGN17744 24/2x/1 Pinnatisecta PNT44 48 III
44. Solanum polyadenium Greenm. Mexico CGN23013 24/2x/1 Polyadenia PLD13 31 V
45. Solanum polyadenium Greenm. Mexico CGN23014 24/2x/1 Polyadenia PLD14 31 V
46. Solanum polyadenium Greenm. Mexico PI 275237 24/2x/1 Polyadenia PLD37 28 V
47. Solanum polyadenium Greenm. Mexico PI 275238 24/2x/1 Polyadenia PLD38 29 V
48. Solanum polyadenium Greenm. Mexico PI 320342 24/2x/1 Polyadenia PLD42 34 V
49. Solanum polyadenium Greenm. Mexico PI 558443 24/2x/1 Polyadenia PLD43 39 V
50. Solanum polyadenium Greenm. Mexico PI 558445 24/2x/1 Polyadenia PLD45 35 V
51. Solanum polyadenium Greenm. Mexico CGN17746 24/2x/1 Polyadenia PLD46 31 V
52. Solanum polyadenium Greenm. Mexico CGN17747 24/2x/1 Polyadenia PLD47 34 V
53. Solanum polyadenium Greenm. Mexico CGN17748 24/2x/1 Polyadenia PLD48 32 V
54. Solanum polyadenium Greenm. Mexico CGN17749 24/2x/1 Polyadenia PLD49 30 V
55. Solanum polyadenium Greenm. Mexico PI 310963 24/2x/1 Polyadenia PLD63 33 V
56. Solanum polyadenium Greenm. Mexico PI 230480 24/2x/1 Polyadenia PLD80 36 V
57. Solanum polyadenium Greenm. Mexico CIP761014 24/2x/1 Polyadenia PLDCIP14 26 V
58. Solanum polyadenium Greenm. Mexico CIP760724 24/2x/1 Polyadenia PLDCIP24 29 V
59. Solanum polytrichon Rydb. Mexico CGN18318 24/2x/2 Longipedicellata PLT18 35 II
60. Solanum polytrichon Rydb. Mexico CGN17750 24/2x/2 Longipedicellata PLT50 39 II
61. Solanum polytrichon Rydb. Mexico CGN17751 24/2x/2 Longipedicellata PLT51 41 II
62. Solanum polytrichon Rydb. Mexico CGN22361 24/2x/2 Longipedicellata PLT61 32 II
63. Solanum polytrichon Rydb. Mexico CGN22362 24/2x/2 Longipedicellata PLT62 36 I
64. Solanum stenophyllidium Bitter Mexico CGN17603 24/2x/1 Pinnatisecta SPH03 36 I
65. Solanum stoloniferum Schltdl. Mexico PI 275240 48/4x/2 Longipedicellata STO40 38 II
66. Solanum stoloniferum Schltdl. Mexico PI 225661 48/4x/2 Longipedicellata STO61 33 I
67. Solanum trifidum Correll Mexico PI 283104 24/2x/1 Pinnatisecta TRF04 37 IV
68. Solanum trifidum Correll Mexico CGN22722 24/2x/1 Pinnatisecta TRF22 28 I
69. Solanum trifidum Correll Mexico CGN18335 24/2x/1 Pinnatisecta TRF35 41 IV
70 Solanum trifidum Correll Mexico PI 255537 24/2x/1 Pinnatisecta TRF37 32 IV
71. Solanum trifidum Correll Mexico PI 255539 24/2x/1 Pinnatisecta TRF39 47 IV
72. Solanum trifidum Correll Mexico PI 255541 24/2x/1 Pinnatisecta TRF41 38 IV
73. Solanum trifidum Correll Mexico PI 255542 24/2x/1 Pinnatisecta TRF42 45 IV
74. Solanum trifidum Correll Mexico PI 283064 24/2x/1 Pinnatisecta TRF64 40 IV
75. Solanum trifidum Correll Mexico PI 283065 24/2x/1 Pinnatisecta TRF65 41 IV
76. Solanum verrucosum Schltdl. Mexico PI 275255 24/2x/2 Tuberosa VER55 34 II
77. Solanum verrucosum Schltdl. Mexico PI 275256 24/2x/2 Tuberosa VER56 39 II
78. Solanum verrucosum Schltdl. Mexico PI 275257 24/2x/2 Tuberosa VER57 30 II
79. Solanum verrucosum Schltdl. Mexico PI 275258 24/2x/2 Tuberosa VER58 35 II
80. Solanum verrucosum Schltdl. Mexico PI 275259 24/2x/2 Tuberosa VER59 30 II
81. Solanum verrucosum Schltdl. Mexico PI 275260 24/2x/2 Tuberosa VER60 25 II
82. Solanum vernei Bitter & Wittm. Argentina PI 320330 24/2x/2 Tuberosa VRN30 21 I
Open in a new tab

aPotato gene bank IDs, starting with PI, CGN and CIP are obtained from Potato Introduction Station, NRSP-6, Sturgeon Bay, Wisconsin (USA); Centre for Genetic Resources, the Netherlands (CGN); and International Potato Centre, Lima, Peru, respectively

b‘Lab code’ was used in this study to denote the accessions on the cluster tree and images, due to space limitations

cTotal number of alleles of all 14 SSR markers scored in the accession

dAuthority of Solanum hannemanii is not available

Fig. 1.

Fig. 1

Open in a new tab

Twenty-two wild potato (Solanum) species were used for SSR analysis. Due to space limitation on the image panel, accessions are mentioned here: Solanum acaule (CGN17938), S. berthaultii (PI 265858), S. cardiophyllum (PI 283062), S. chacoense (PI 197760), S. chomatophilum (PI 310990), S. hannemanii (CGN18001), S. hjertingii (PI 283103), S. hougasii (PI 161727), S. huancabambense (CGN18306), S. iopetalum (PI 275180), S. jamesii (CGN18346), S. lesteri (PI 558434), S. medians (PI 283081), S. microdontum (PI 195185), S. pinnatisectum (CGN17744), S. polyadenium (PI 230480), S. polytrichon (CGN17750), S. stenophyllidium (CGN17603), S. stoloniferum (PI 225661), S. trifidum (PI 255537), S. verrucosum (PI 275256), and S. vernei (PI 320330)

DNA analysis

Leaf tissues of 82 accessions were collected and total genomic DNA was isolated using the DNeasy® Plant Mini Kit (Qiagen, Venlo, Limburg, Netherlands) following manufacturer’s instructions. DNA quantification was performed with NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific, Wilmington, USA), and quality was checked on 1% (w/v) agarose gel for SSR analysis. Fourteen SSR markers (12 markers, one per chromosome from the PGI kit, Ghislain et al. 2009; and two polymorphic markers, STIKA and STU6SNRN, Provan et al. 1996) were used for polymerase chain reaction (PCR) amplification (Table 1). The PCR reaction was performed in 25 µL volume with DNA template (100 ng) in 1 × PCR buffer (2.5 mM/L MgCl2 and 200 µM/L dNTP), each primer (0.5 µM/L), and Taq polymerase (1U) (Qiagen, Venlo, Limburg, Netherlands) following initial denaturation at 94 °C/5 min; followed by 35 cycles of 94 °C/45 s, 51–60 °C/45 s, and 72 °C/1 min; and final extension at 72 °C/8 min in a Veriti Thermal Cycler (Life Technologies, Carlsbad, California, USA). The amplified SSR fragments were analysed with a 500-bp ‘GS 500 ROX’ standard on ‘3500 Genetic Analyzer’ using GeneMapper® Software Version 4.1 (Applied Biosystems, California, USA).

Data scoring and analysis

PCR reactions were repeated at least twice, and only reproducible, distinct, and scorable SSR alleles across the run were considered for analysis. A data matrix of 82 accessions was prepared on the basis of presence (1) or absence (0) of the alleles. Number of alleles, allele size, absolute frequencies and polymorphic information content (PIC) of markers were calculated for 82 samples. The PIC value of SSR markers was calculated according to the formula: PIC=1-∑(Pi2), where Pi is the frequency of the ith allele of a marker detected in accessions (Nei 1973). A similarity matrix of SSR profiles was estimated based on the Dice similarity coefficient using the neighbour-joining clustering method using DARwin software with bootstrap value 100 (Perrier and Jacquemoud-Collet 2006). The principal component analysis (PCA) was analysed to assess the genetic association among the wild species using the software NTSYSpc (Rohlf 2006).

Results

SSR polymorphism

Allelic profiling of 82 accessions belonging to 22 wild potato species showed polymorphism using 14 SSR markers (Table 1). A summary of distribution of SSR alleles’ size, number of alleles, and PIC value is presented in Table 2. SSR analysis showed 109 alleles of 14 polymorphic SSR loci in wild species. The allele size ranged from a minimum of 104 bp (STI0030) to a maximum of 304 bp (STM5114). The number of alleles per marker ranged from 4 (STM5127/STM1053) to 13 (STM0019), whereas the PIC value varied between 0.66 (STM1053) and 0.91 (STM0019) (Table 3). The most informative SSR allele was 208 bp of STM1052, which amplified to maximum in 80 accessions, whereas 121 bp of STI0030 marker was found to be minimum in 3 accessions. A total of 2929 SSR alleles were amplified in all 82 accessions by 14 markers, which varied from 21 (VRN30) to 49 (PNT41) in the accessions. A dataset of SSR alleles was developed for all the accessions (Table 1 and Suppl. File S1). Several markers had either nil or very minor or non-scorable fragments shown as ‘Nil’ (null alleles) in Suppl. File S1.

Table 2.

Molecular profiling of wild potato species by SSR markers.

SSR markers source: Ghislain et al. (2009) (#1–12) and Provan et al. (1996) (#13–14)

S. no. SSR marker Repeat motif Sequence (5′ → 3′) Map location Alleles size (bp) Number of alleles Ta (°C) PIC
1 STM5127 (TCT)n

F: TTCAAGAATAGGCAAAACCA

R: CTTTTTCTGACTGAGTTGCCTC

 I 237–247 4 55 0.74
2 STM5114 (ACC)n

F: AATGGCTCTCTCTGTATGCT

R: GCTGTCCCAACTATCTTTGA

 II 275–304 6 60 0.80
3 STM1053 (TA)n (ATC)n

F: TCTCCCCATCTTAATGTTTC

R: CAACACAGCATACAGATCATC

 III 165–180 4 53 0.66
4 STI0012 (ATT)n

F: GAAGCGACTTCCAAAATCAGA

R: AAAGGGAGGAATAGAAACCAAAA

 IV 148–226 7 56 0.81
5 STPoAc58 (TA)n

F: TTGATGAAAGGAATGCAGCTTGTG

R: ACGTTAAAGAAGTGAGAGTACGAC

 V 218–251 7 57 0.77
6 STM0019a (AT)n (GT)n (AT)n (GT)n (GC)n (GT)n

F: AATAGGTGTACTGACTCTCAATG

R: TTGAAGTAAAAGTCCTAGTATGTG

 VI 108–247 13 55 0.91
7 STM0031 (AC)n…(AC)n GCAC (AC)n (GCAC)n

F: CATACGCACGCACGTACAC

R: TTCAACCTATCATTTTGTGAGTCG

 VII 137–272 8 53 0.83
8 STM1104 (TCT)n

F: TGATTCTCTTGCCTACTGTAATCG

R: CAAAGTGGTGTGAAGCTGTGA

 VIII 147–180 7 53 0.81
9 STM1052 (AT)n GT (AT)n (GT)n

F: CAATTTCGTTTTTTCATGTGACAC

R: ATGGCGTAATTTGATTTAATACGTAA

 IX 141–300 10 55 0.77
10 STM1106 (ATT)n

F: TCCAGCTGATTGGTTAGGTTG

R: ATGCGAATCTACTCGTCATGG

 X 124–294 11 51 0.87
11 STM0037 (TC)n (AC)n AA (AC)n (AT)n

F: AATTTAACTTAGAAGATTAGTCTC

R: ATTTGGTTGGGTATGATA

 XI 130–289 10 52 0.85
12 STI0030 (ATT)n

F: TTGACCCTCCAACTATAGATTCTTC

R: TGACAACTTTAAAGCATATGTCAGC

 XII 104–139 6 58 0.81
13 STU6SNRN (TGG)5

F: GAAGTTTTATCAGAATCC

R: ATCACCTCATCAGCAATC

 – 145–204 9 55 0.85
14 STIKA (T)12(A)9ATTCTTGTT(TA)2 CA(TA)7

F: TTCGTTGCTTACCTACTA

R: CCCAAGATTACCACATTC

 – 175–233 7 55 0.82
Total 109
Open in a new tab

PIC polymorphic information content, Ta annealing temperature

aAll SSR amplified at single locus except, STM019 amplifies at two loci (Ghislain et al. 2009)

Table 3.

Distribution of SSR allele size (bp) and its absolute frequency in wild potato species

SSR primer Allele size (absolute frequency)
STM5127 237 (43), 241 (40), 244 (25), 247 (37)
STM5114 275 (32), 281 (55), 284 (50), 287 (37), 290 (34), 304 (9)
STM1053 165 (65), 170 (78), 173 (28), 180 (11)
STI0012 148 (26), 161 (22), 167 (44), 194 (54), 199 (30), 205 (13), 226 (7)
STPoAc58 218 (47), 226 (59), 232 (23), 236 (21), 240 (13), 247 (9), 251 (5)
STM0019 108 (18), 118 (27), 126 (20), 145 (20), 156 (24), 162 (27), 166 (24), 172 (12), 180 (10), 189 (27), 195 (14), 206 (38), 247 (14)
STM0031 137 (35), 149 (40), 155 (12), 184 (9), 204 (14), 229 (37), 254 (12), 272 (18)
STM1104 147 (27), 151 (47), 154 (42), 160 (30), 164 (58), 171 (11), 180 (10)
STM1052 141 (24), 154 (5), 165 (4), 179 (10), 201 (38), 208 (80), 217 (8), 230 (6), 161 (13), 300 (12)
STM1106 124 (58), 127 (33), 130 (48), 139 (30), 146 (32), 155 (21), 169 (7), 182 (11), 235 (10), 268 (7), 294 (17)
STM0037 130 (17), 142 (10), 149 (10), 160 (19), 178 (47), 187 (18), 193 (15), 221 (7), 237 (13), 289 (7)
STI0030 104 (7), 109 (5), 115 (5), 121 (3), 135 (8), 139 (10)
STU6SNRN 145 (16), 153 (31), 169 (22), 177 (36), 181 (69), 190 (78), 194 (41), 199 (66), 204 (20)
STIKA 175 (21), 194 (64), 200 (54), 208 (62), 213 (33), 218 (17), 233 (29)
Open in a new tab

Absolute frequency is the number of accessions in which the SSR amplified, out of total of 82 accessions used in the study. (e.g., absolute frequency will be a maximum of 82, if SSR amplified in all 82 accessions; and 0 if not amplified in any accession)

Cluster analysis

Cluster analysis of wild species distinguished all the accessions based on the Jaccard’s similarity coefficient (0.19–0.80) by 14 SSR markers (Fig. 2). All accessions were classified into major five clusters (I–V) based on the allelic profiles. Most accessions were categorised into the respective species cluster except a few like VRN30. Allelic variation was observed within the species. For example, accessions (BER25, BER58 and BER96) of S. berthaultii species were grouped into cluster II except BER57 (cluster III); S. jamesii and S. pinnatisectum species accessions were grouped into cluster III except JAM46, PNT42 and PNT43 (cluster I); S. trifidum accessions were grouped into cluster IV except TRF22 (cluster I). Genetic association in the wild species was shown by principal component analysis (PCA). The PCA analysis showed a total variance of 45.15% by calculating the first three components as 33.60, 6.67 and 4.87% and PCA plot showing the first two principal components (Dim-1 and Dim-2) is depicted in Suppl. File S2.

Fig. 2.

Fig. 2

Open in a new tab

Diversity analysis of 82 accessions belonging to 22 wild species using 14 SSR markers based on the Dice coefficient using the weighted neighbour-joining tree construction method. Bootstrap values are shown on the nodes. Different colours are shown to represent the species

Discussion

We observed allelic variations in 82 accessions of 22 wild potato (Solanum) species by 109 alleles of 14 polymorphic SSR markers. All markers showed polymorphism based on the PIC values (0.66–0.91) distributed across the SSR loci in the accessions. SSR studies have shown good discrimination power and polymorphism in closely related potato species such as varietal identification (Powell et al. 1996) and characterization of wild species (Carputo et al. 2013). SSR allows labelling of genotypes to reveal genetic variation in potato (Ghislain et al. 2009) and germplasm management of reference collection (Reid et al. 2011). Our findings are congruent with earlier SSR studies on allelic variation including observation on null alleles (Provan et al. 1996; Ghislain et al. 2009) and validation of Andigena core collection (Tiwari et al. 2013). Allelic profiles in terms of size, number and absolute frequencies observed in this study showed little deviation in comparison with earlier findings (Provan et al. 1996; Ghislain et al. 2009). Probably, this could be due to the equipment types and software technologies used to analyse SSR alleles. We used a high-throughput fragment analysis system, i.e., ‘3500 Genetic Analyzer’ (Applied Biosystems) that has high precision, whilst earlier workers might have used a semi-automated gel-based method to score SSR alleles. Moreover, we used this system for molecular characterization of wild species and interspecific somatic hybrids (Sarkar et al. 2011; Chandel et al. 2015) and identification of potato varieties using SSR markers (Tiwari et al. 2018a). We observed null alleles in a few accessions with some SSR markers. Similar observations of null alleles have been reported earlier by Galarreta et al. (2011) on characterization of potato landraces and by Tiwari et al. (2013) on characterization of Andigena core collection.

Our earlier study showed high allelic diversity with a range of PIC values (0.53–0.92) using SSR markers in characterization of Indian potato varieties (Tiwari et al. 2018a). Similarly, high SSR allelic diversity has also been reported in potato landraces by Galarreta et al. (2011). Researchers have suggested that SSR markers are a useful tool to investigate genetic variations in closely related taxa of potato (Solanum tuberosum subsp. tuberosum and subsp. andigenum) due to allelic polymorphism and high degree of heterozygosity in microsatellite regions (Raker and Spooner 2002). Cluster and PCA analysis in this study using 14 SSR markers reflected genetic distinctness among the accessions of the wild species. Cluster analysis showed the maximum value of Jaccard’s similarity coefficients to be 0.80 by 14 SSR to distinguish the accessions. An SSR database of potato varieties of the European Union common catalogue has been developed showing unique profiles (Reid et al. 2011). We developed a dataset of SSR markers for identification of potato varieties (Tiwari et al. 2018a). Thus, the above studies show the versatility of the SSR system for molecular characterization of potatoes.

South America is the centre of origin of potato and the Solanum species originated from the Andean regions of Peru, Bolivia and Argentina in South America and Mexico/Central America (Hawkes 1990). Distinct variations have been observed in this study by SSR markers within the species and between/among the accessions with respect to allelic distribution, which could be due to genomic changes during evolutionary process of the species (Provan et al. 1996). In potato, since each TPS is genetically different from another TPS, allelic variation could be expected among the accessions and within the species. Diversity based on the SSR alleles has been observed in the accessions irrespective of the origin country, series and species. The 82 accessions used in this study originated mostly from Mexico (61) followed by Argentina (7), Bolivia (5), the United States of America (5) and Peru (4). Interestingly, the wild species that originated from South American countries like Argentina (S. acaule, S. chacoense, S. hannemanii, S. microdontum and S. vernei) and Peru (S. chomatophilum, S. huancabambense and S. medians) have been grouped into cluster I. On the contrary, Mexico-originated species (S. cardiophyllum, S. hjertingii, S. hougasii, S. iopetalum, S. lesteri, S. pinnatisectum, S. polyadenium, S. polytrichon, S. stenophyllidium, S. stoloniferum, S. trifidum, and S. verrucosum) have been grouped differently into all five clusters, whereas Bolivia (S. acaule and S. berthaultii) and the United States of America (S. jamesii) species have been grouped into various clusters.

To conclude, allelic profiling of wild potato species by SSR markers, development of a dataset of alleles and diversity among the accessions of the species are important information for future application of these species. These wild species are an important resource of resistance genes for various biotic and abiotic stresses and could be characterized for more traits like late blight resistance (Tiwari et al. 2015). Future study should be focused on the identification of SSR alleles linked to target traits and their deployment in future improvement programmes applying breeding and biotechnological approaches.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary material 1 (DOC 236 kb) (236.5KB, doc)

Acknowledgements

The authors thank the Competent Authority, ICAR-CPRI, Shimla; Germplasm and Biotechnology programmes (HORTCPRICIL201500300131); and CABin scheme (IASRI, New Delhi) for necessary support. Special thanks to Mr. Sheeshram Thakur for in vitro maintenance of wild species, and Mr. CM Bist for SSR analysis. The International GenBank are gratefully acknowledged for providing the TPS of the wild species.

Author contributions

JKT designed the experiment. JKT, NL, SD and RZ performed the SSR analysis. VK provided the samples. JKT analysed the data and wrote the manuscript, and SKC edited it. All authors read and confirmed the manuscript.

Compliance with ethical standards

Conflict of interest

The authors declare that there is no conflict of interest.

References

  1. Bradshaw JE, Bryan GJ, Ramsay G. Genetic resources (including wild and cultivated Solanum species) and progress in their utilisation in potato breeding. Potato Res. 2006;49:49–65. doi: 10.1007/s11540-006-9002-5. [DOI] [Google Scholar]
  2. Carputo D, Alioto D, Aversano R, Garramone R, Miraglia V, Villano C, Frusciante L. Genetic diversity among potato species as revealed by phenotypic resistances and SSR markers. Plant Genet Resour Character Utiliz. 2013;11:131–139. doi: 10.1017/S1479262112000500. [DOI] [Google Scholar]
  3. Chakrabarti SK, Conghua X, Tiwari JK. The potato genome. Basel: Springer; 2017. [Google Scholar]
  4. Chandel P, Tiwari JK, Ali N, Devi S, Sharma SH, Sharma SA, Luthra SK, Singh BP. Interspecific potato somatic hybrids between Solanum tuberosum and S. cardiophyllum, potential sources of late blight resistance breeding. Plant Cell Tiss Organ Cult. 2015;123:579–589. doi: 10.1007/s11240-015-0862-8. [DOI] [Google Scholar]
  5. Galarreta JIR, Barandalla L, Rios DJ, Lopez R, Ritter E. Genetic relationships among local potato cultivars from Spain using SSR markers. Genet Resour Crop Evol. 2011;58:383–395. doi: 10.1007/s10722-010-9583-3. [DOI] [Google Scholar]
  6. Ghislain M, Nuñez J, Herrera MR, Pignataro J, Guzmán N, Bonierbale M, Spooner DM. Robust and highly informative microsatellite-based genetic identity kit for potato. Mol Breed. 2009;23:377–388. doi: 10.1007/s11032-008-9240-0. [DOI] [Google Scholar]
  7. Gopal J, Kumar V, Sandhu SK. Biosystematics and genetic resources of potato. In: Khurana SMP, Minhas JS, Pandey SK, editors. The potato production and utilization in subtropics. New Delhi: Mehta Publishers; 2003. pp. 31–47. [Google Scholar]
  8. Hawkes JG. The potato: evolution, biodiversity and genetic resources. Washington, DC: Belhaven Press; 1990. [Google Scholar]
  9. Hijmans RJ, Spooner DM. Geographic distribution of wild potato species. Am J Bot. 2001;88:2101–2112. doi: 10.2307/3558435. [DOI] [PubMed] [Google Scholar]
  10. Liao H, Guo H. Using SSR to evaluate the genetic diversity of potato cultivars from Yunnan province (SW China) Acta Biol Cracov Ser Bot. 2014;56(1):16–27. [Google Scholar]
  11. Machida-Hirano R, Niino T. Potato genetic resources. In: Chakrabarti SK, Conghua X, Tiwari JK, editors. The potato genome. Basel: Springer; 2017. pp. 11–30. [Google Scholar]
  12. Nei M. Analysis of gene diversity in subdivided populations. Proc Natl Acad Sci USA. 1973;70:3321–3323. doi: 10.1073/pnas.70.12.3321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Perrier X, Jacquemoud-Collet JP (2006) DARwin software. http://darwin.cirad.fr/darwin. Accessed 30 Apr 2019
  14. Powell W, Morgante M, Andre C, Hanafey M, Vogel MJ, Tingey SV, Rafalski A. The comparison of RFLP, RAPD, AFLP and SSR (microsatellites) markers for germplasm analysis. Mol Breed. 1996;2:225–235. doi: 10.1007/BF00564200. [DOI] [Google Scholar]
  15. Provan J, Powell W, Waugh R. Microsatellite analysis of relationships within cultivated potato (Solanum tuberosum) Theor Appl Genet. 1996;92:1078–1084. doi: 10.1007/BF00224052. [DOI] [PubMed] [Google Scholar]
  16. Raker CM, Spooner DM. Chilean tetraploid cultivated potato, Solanum tuberosum, is distinct from the Andean populations: microsatellite data. Crop Sci. 2002;42:1451–1458. doi: 10.2135/cropsci2002.1451. [DOI] [Google Scholar]
  17. Reid A, Hof L, Felix G, Rücker B, Tams S, Milczynska E, Esselink D, Uenk G, Vosman B, Weitz A. Construction of an integrated microsatellite and key morphological characteristic database of potato varieties on the EU common catalogue. Euphytica. 2011;182:239–249. doi: 10.1007/s10681-011-0462-6. [DOI] [Google Scholar]
  18. Rohlf F. NTSYSpc: numerical taxonomy system (ver. 2.2) Setauket: Exeter Publishing, Ltd.; 2006. [Google Scholar]
  19. Sarkar D, Tiwari JK, Sharma S, Poonam Sharma Sanjeev, Gopal J, Singh BP, Luthra SK, Pandey SK, Pattanayak D. Production and characterization of somatic hybrids between Solanum tuberosum L. and S. pinnatisectum Dun. Plant Cell Tiss Organ Cult. 2011;107:427–440. doi: 10.1007/s11240-011-9993-8. [DOI] [Google Scholar]
  20. Tiwari JK, Singh BP, Gopal J, Poonam Patil VU. Molecular characterization of the Indian Andigena potato core collection using microsatellite markers. Afr J Biotechnol. 2013;12:1025–1033. [Google Scholar]
  21. Tiwari JK, Devi S, Sharma S, Chandel P, Rawat S, Singh BP. Allele mining in Solanum germplasm: cloning and characterization of RB-homologous gene fragments from late blight resistant wild potato species. Plant Mol Biol Rep. 2015;33:1584–1598. doi: 10.1007/s11105-015-0859-9. [DOI] [Google Scholar]
  22. Tiwari JK, Kumar V, Devi S, Luthra SK, Chakrabarti SK, Rawat S, Nagesh M. Genomics in management and genetic enhancement of potato germplasm. In: Chakrabarti SK, Conghua X, Tiwari JK, editors. The potato genome. Basel: Springer; 2017. pp. 123–142. [Google Scholar]
  23. Tiwari JK, Ali N, Devi S, Kumar V, Zinta R, Chakrabarti SK. Development of microsatellite markers set for identification of Indian potato varieties. Sci Hort. 2018;231:22–30. doi: 10.1016/j.scienta.2017.11.027. [DOI] [Google Scholar]
  24. Tiwari JK, Devi S, Ali N, Luthra SK, Kumar V, Bhardwaj V, Singh RK, Rawat S, Chakrabarti SK. Progress in somatic hybridization research in potato during the past 40 years. Plant Cell Tiss Organ Cult. 2018;132:225–238. doi: 10.1007/s11240-017-1327-z. [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary material 1 (DOC 236 kb) (236.5KB, doc)

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES