Abstract
Allelic variation in wild potato (Solanum) species was analysed using 14 simple sequence repeat (SSR) markers. SSR allelic profiles showed high polymorphism and distinctness among the wild species. A total of 109 alleles of 14 polymorphic SSR markers were scored in 82 accessions belonging to 22 wild potato species. Allele size ranged from a minimum of 104 bp (STI0030) to a maximum of 304 bp (STM5114). Number of SSR alleles per marker ranged from 4 (STM5127/STM1053) to 13 (STM0019), whereas PIC value varied between 0.66 (STM1053) and 0.91 (STM0019). Cluster analysis using SSR allelic profiles of 82 accessions grouped showed 5 major clusters (I–V) based on the Dice similarity coefficient using neighbour-joining clustering method. Distinct allelic variations were observed among the accessions irrespective of the origin country, series and species. Our study suggests that SSR-based molecular characterization of wild potato species is accession specific and development of an allelic dataset for all the accessions would strengthen their utilization in potato research in future.
Electronic supplementary material
The online version of this article (10.1007/s13205-019-1785-6) contains supplementary material, which is available to authorized users.
Keywords: Alleles, Diversity, Potato, SSR marker, Solanum species
Introduction
Potato (Solanum tuberosum L.) plays a key role in the global food and nutritional security after rice, wheat and maize (Chakrabarti et al. 2017). With increasing population and more food demand compounded with disease pests’ pressure and climate change, enhancing potato production is necessary through development of new varieties using diverse genetic resources like wild/semi and cultivated Solanum species in potato. Potato belongs to a diverse gene pool which includes more than 200 Solanum species possessing various desirable traits and biotic/abiotic stresses (Machida-Hirano and Niino 2017). A few potato species have been utilized in breeding (Bradshaw et al. 2006), pre-breeding and biotechnology like somatic fusion (Tiwari et al. 2018b) and still many more species need to be applied.
The potato (Solanum) species consist of diploids (73%), triploids (4%), tetraploids (15%), pentaploids (2%) and hexaploids (6%) (Gopal et al. 2003). The cultivated potato is Solanum tuberosum ssp. tuberosum (long-days adapted) and is found naturally in southern Chile, whereas Solanum tuberosum ssp. andigena (short-days adapted) is widely distributed in the Andean regions of Venezuela and northern Argentina (Gopal et al. 2003). Besides, primitive cultivated species are confined to the Andes of South America, which are S. phureja (2n = 2x = 24), S. chaucha (2n = 3x = 36), S. stenotomum (2n = 2x = 24), S. goniocalyx (2n = 2x = 24), S. curtilobum (2n = 5x = 60), S. juzepczukii (2n = 3x = 36) and S. ajanhuiri (2n = 2x = 24) (Machida-Hirano and Niino 2017). Wild species are adapted to stress environments such as frost (e.g. S. acaule), dry semi-desert (e.g. S. berthaultii), cool temperate (e.g. S. colombianum Dun.), and coastal plains (S. commersonii and S. chacoense). Wild species also possess resistance to various pests and diseases, for example, resistance to late blight—the most devastating disease of potato—has been introgressed into the cultivated types such as S. tuberosum subsp. andigena, and wild S. demissum, S. stoloniferum, S. phureja, S. chacoense, S. bulbocastanum as well as S. acaule in Europe and America (Bradshaw et al. 2006). In India, late blight resistance in the most popular potato cv. Kufri Jyoti was derived from wild S. demissum and now this variety is highly susceptible. Thus, there are several wild potato species which might be important for potato improvement in the future (Tiwari et al. 2017).
It is essential to characterize wild potato species before their deployment in improvement programmes using molecular markers for their diversity pattern, germplasm management and other similar studies. DNA markers have been used for a long time in potato characterization. Among them, simple sequence repeat (SSR) is an excellent marker system to study closely related genotypes due to co-dominance, locus specific, reproducibility and being capable of high-throughput genotyping (Provan et al. 1996; Powell et al. 1996). Earlier, several researchers have used SSR markers to investigate diversity in potato (Liao and Guo 2014; Tiwari et al. 2013, 2018a), development of potato genetic identity (PGI) kit of 24 SSR markers (Ghislain et al. 2009) and many others. Our aim in this study was to investigate allelic variations in wild potato (Solanum) species by SSR markers, analyse the molecular diversity and develop an SSR allelic dataset for their future application.
Materials and methods
Plant material
Eighty-two accessions belonging to 22 wild potato (Solanum) species were used in this study. Wild accessions were grown in the earthen pots (in triplicates) at Indian Council of Agricultural Research (ICAR)-Central Potato Research Institute (CPRI), Shimla, Himachal Pradesh, India. In vitro plants were raised from true potato seeds (TPS) and multiplied through tissue culture as described by Sarkar et al. (2011). A single mother plant per accession was clonally regenerated. TPS were obtained from the international gene banks namely Potato Introduction Station, NRSP-6, Sturgeon Bay, Wisconsin (USA); Centre for Genetic Resources, Wageningen University and Research, the Netherlands (CGN); and International Potato Centre, Lima, Peru. A brief description of the wild species is summarised in Table 1 and images are shown in Fig. 1.
Table 1.
Details of 82 accessions belonging to 22 wild potato (Solanum) species used in SSR analysis.
Scientific name of wild species along with ploidy/EBN/Chr. no. details are mentioned from the search US Gene bank search: https://npgsweb.ars-grin.gov; or CGN Gene bank search: https://cgngenis.wur.nl; or adapted from Hijmans and Spooner (2001). Nomenclature is based on Hawkes (1990)
| S. no. | Solanum species | Origin country | Genbank IDa | Chr. no./Ploidy/EBN | Series | Lab codeb | # Allelesc | Cluster |
|---|---|---|---|---|---|---|---|---|
| 1. | Solanum acaule Bitter | Bolivia | PI 210029 | 48/4x/2 | Acaulia | ACL29 | 35 | I |
| 2. | Solanum acaule Bitter subsp. aemulans | Argentina | CGN17938 | 48/4x/2 | Acaulia | ACL38 | 30 | I |
| 3. | Solanum berthaultii Hawkes | Bolivia | PI 310925 | 24/2x/2 | Tuberosa | BER25 | 39 | II |
| 4. | Solanum berthaultii Hawkes | Bolivia | PI 265857 | 24/2x/2 | Tuberosa | BER57 | 30 | III |
| 5. | Solanum berthaultii Hawkes | Bolivia | PI 265858 | 24/2x/2 | Tuberosa | BER58 | 36 | II |
| 6. | Solanum berthaultii Hawkes | Bolivia | PI 498096 | 24/2x/2 | Tuberosa | BER96 | 38 | II |
| 7. | Solanum cardiophyllum Lindl. subsp. cardiophyllum | Mexico | CGN18325 | 24/2x/1 | Pinnatisecta | CPH25 | 37 | I |
| 8. | Solanum cardiophyllum Lindl. subsp. cardiophyllum | Mexico | CGN18326 | 24/2x/1 | Pinnatisecta | CPH26 | 32 | I |
| 9. | Solanum cardiophyllum Lindl. | Mexico | PI 283062 | 24/2x/1 | Pinnatisecta | CPH62 | 32 | I |
| 10. | Solanum cardiophyllum Lindl. | Mexico | PI 283063 | 24/2x/1 | Pinnatisecta | CPH63 | 37 | I |
| 11. | Solanum cardiophyllum Lindl. | Mexico | PI 595465 | 24/2x/1 | Pinnatisecta | CPH65 | 38 | I |
| 12. | Solanum cardiophyllum Lindl. subsp. cardiophyllum | Mexico | CGN22387 | 24/2x/1 | Pinnatisecta | CPH87 | 33 | I |
| 13. | Solanum chacoense Bitter | Argentina | PI 197760 | 24/2x/2 | Yungasensa | CHC60 | 38 | I |
| 14. | Solanum chomatophilum Bitter | Peru | PI 310990 | 24/2x/2 | Conicibaccata | CHM90 | 35 | I |
| 15. | Solanum hannemanii d | Argentina | CGN18001 | 24/2x/2 | Tuberosa | HAN01 | 31 | I |
| 16. | Solanum hjertingii Hawkes | Mexico | PI 283103 | 48/4x/2 | Longipedicellata | HJT03 | 28 | I |
| 17. | Solanum hougasii Correll | Mexico | PI 161727 | 72/6x/4 | Demissa | HOU27 | 38 | II |
| 18. | Solanum huancabambense Ochoa | Peru | CGN18306 | 24/2x/2 | Yungasensa | HCB06 | 27 | I |
| 19. | Solanum huancabambense Ochoa | Peru | CGN17719 | 24/2x/2 | Yungasensa | HCB19 | 35 | I |
| 20. | Solanum iopetalum (Bitter) Hawkes | Mexico | PI 239402 | 72/6x/4 | Demissa | IOP02 | 46 | II |
| 21. | Solanum iopetalum (Bitter) Hawkes | Mexico | PI 230459 | 72/6x/4 | Demissa | IOP59 | 35 | II |
| 22. | Solanum iopetalum (Bitter) Hawkes | Mexico | PI 275180 | 72/6x/4 | Demissa | IOP80 | 44 | II |
| 23. | Solanum jamesii Torr. | United States of America | PI 498407 | 24/2x/1 | Pinnatisecta | JAM07 | 33 | III |
| 24. | Solanum jamesii Torr. | United States of America | CGN18346 | 24/2x/1 | Pinnatisecta | JAM46 | 36 | I |
| 25. | Solanum jamesii Torr. | United States of America | CGN18349 | 24/2x/1 | Pinnatisecta | JAM49 | 39 | III |
| 26. | Solanum jamesii Torr. | United States of America | CIP762777 | 24/2x/1 | Pinnatisecta | JAM77 | 47 | III |
| 27. | Solanum jamesii Torr. | United States of America | PI 558089 | 24/2x/1 | Pinnatisecta | JAM89 | 42 | III |
| 28. | Solanum lesteri Hawkes & Hjert. | Mexico | CGN24429 | 24/2x/1 | Polyadenia | LES29 | 32 | V |
| 29. | Solanum lesteri Hawkes & Hjert. | Mexico | PI 558434 | 24/2x/1 | Polyadenia | LES34 | 35 | V |
| 30. | Solanum lesteri Hawkes & Hjert. | Mexico | CGN18337 | 24/2x/1 | Polyadenia | LES37 | 44 | V |
| 31. | Solanum lesteri Hawkes & Hjert. | Mexico | CGN23988 | 24/2x/1 | Polyadenia | LES88 | 32 | V |
| 32. | Solanum medians Bitter | Peru | PI 283081 | 24/2x/2 | Tuberosa | MED81 | 39 | I |
| 33. | Solanum microdontum Bitter | Argentina | PI 218224 | 24/2x/2 | Tuberosa | MCD24 | 27 | I |
| 34. | Solanum microdontum Bitter | Argentina | PI 473171 | 24/2x/2 | Tuberosa | MCD71 | 30 | I |
| 35. | Solanum microdontum Bitter | Argentina | PI 195185 | 24/2x/2 | Tuberosa | MCD85 | 42 | I |
| 36. | Solanum pinnatisectum Dunal | Mexico | CGN23011 | 24/2x/1 | Pinnatisecta | PNT11 | 46 | III |
| 37. | Solanum pinnatisectum Dunal | Mexico | CGN23012 | 24/2x/1 | Pinnatisecta | PNT12 | 40 | III |
| 38. | Solanum pinnatisectum Dunal | Mexico | CGN18331 | 24/2x/1 | Pinnatisecta | PNT31 | 48 | III |
| 39. | Solanum pinnatisectum Dunal | Mexico | CGN17740 | 24/2x/1 | Pinnatisecta | PNT40 | 47 | III |
| 40. | Solanum pinnatisectum Dunal | Mexico | CGN17741 | 24/2x/1 | Pinnatisecta | PNT41 | 49 | III |
| 41. | Solanum pinnatisectum Dunal | Mexico | CGN17442 | 24/2x/1 | Pinnatisecta | PNT42 | 33 | I |
| 42. | Solanum pinnatisectum Dunal | Mexico | CGN17443 | 24/2x/1 | Pinnatisecta | PNT43 | 35 | I |
| 43. | Solanum pinnatisectum Dunal | Mexico | CGN17744 | 24/2x/1 | Pinnatisecta | PNT44 | 48 | III |
| 44. | Solanum polyadenium Greenm. | Mexico | CGN23013 | 24/2x/1 | Polyadenia | PLD13 | 31 | V |
| 45. | Solanum polyadenium Greenm. | Mexico | CGN23014 | 24/2x/1 | Polyadenia | PLD14 | 31 | V |
| 46. | Solanum polyadenium Greenm. | Mexico | PI 275237 | 24/2x/1 | Polyadenia | PLD37 | 28 | V |
| 47. | Solanum polyadenium Greenm. | Mexico | PI 275238 | 24/2x/1 | Polyadenia | PLD38 | 29 | V |
| 48. | Solanum polyadenium Greenm. | Mexico | PI 320342 | 24/2x/1 | Polyadenia | PLD42 | 34 | V |
| 49. | Solanum polyadenium Greenm. | Mexico | PI 558443 | 24/2x/1 | Polyadenia | PLD43 | 39 | V |
| 50. | Solanum polyadenium Greenm. | Mexico | PI 558445 | 24/2x/1 | Polyadenia | PLD45 | 35 | V |
| 51. | Solanum polyadenium Greenm. | Mexico | CGN17746 | 24/2x/1 | Polyadenia | PLD46 | 31 | V |
| 52. | Solanum polyadenium Greenm. | Mexico | CGN17747 | 24/2x/1 | Polyadenia | PLD47 | 34 | V |
| 53. | Solanum polyadenium Greenm. | Mexico | CGN17748 | 24/2x/1 | Polyadenia | PLD48 | 32 | V |
| 54. | Solanum polyadenium Greenm. | Mexico | CGN17749 | 24/2x/1 | Polyadenia | PLD49 | 30 | V |
| 55. | Solanum polyadenium Greenm. | Mexico | PI 310963 | 24/2x/1 | Polyadenia | PLD63 | 33 | V |
| 56. | Solanum polyadenium Greenm. | Mexico | PI 230480 | 24/2x/1 | Polyadenia | PLD80 | 36 | V |
| 57. | Solanum polyadenium Greenm. | Mexico | CIP761014 | 24/2x/1 | Polyadenia | PLDCIP14 | 26 | V |
| 58. | Solanum polyadenium Greenm. | Mexico | CIP760724 | 24/2x/1 | Polyadenia | PLDCIP24 | 29 | V |
| 59. | Solanum polytrichon Rydb. | Mexico | CGN18318 | 24/2x/2 | Longipedicellata | PLT18 | 35 | II |
| 60. | Solanum polytrichon Rydb. | Mexico | CGN17750 | 24/2x/2 | Longipedicellata | PLT50 | 39 | II |
| 61. | Solanum polytrichon Rydb. | Mexico | CGN17751 | 24/2x/2 | Longipedicellata | PLT51 | 41 | II |
| 62. | Solanum polytrichon Rydb. | Mexico | CGN22361 | 24/2x/2 | Longipedicellata | PLT61 | 32 | II |
| 63. | Solanum polytrichon Rydb. | Mexico | CGN22362 | 24/2x/2 | Longipedicellata | PLT62 | 36 | I |
| 64. | Solanum stenophyllidium Bitter | Mexico | CGN17603 | 24/2x/1 | Pinnatisecta | SPH03 | 36 | I |
| 65. | Solanum stoloniferum Schltdl. | Mexico | PI 275240 | 48/4x/2 | Longipedicellata | STO40 | 38 | II |
| 66. | Solanum stoloniferum Schltdl. | Mexico | PI 225661 | 48/4x/2 | Longipedicellata | STO61 | 33 | I |
| 67. | Solanum trifidum Correll | Mexico | PI 283104 | 24/2x/1 | Pinnatisecta | TRF04 | 37 | IV |
| 68. | Solanum trifidum Correll | Mexico | CGN22722 | 24/2x/1 | Pinnatisecta | TRF22 | 28 | I |
| 69. | Solanum trifidum Correll | Mexico | CGN18335 | 24/2x/1 | Pinnatisecta | TRF35 | 41 | IV |
| 70 | Solanum trifidum Correll | Mexico | PI 255537 | 24/2x/1 | Pinnatisecta | TRF37 | 32 | IV |
| 71. | Solanum trifidum Correll | Mexico | PI 255539 | 24/2x/1 | Pinnatisecta | TRF39 | 47 | IV |
| 72. | Solanum trifidum Correll | Mexico | PI 255541 | 24/2x/1 | Pinnatisecta | TRF41 | 38 | IV |
| 73. | Solanum trifidum Correll | Mexico | PI 255542 | 24/2x/1 | Pinnatisecta | TRF42 | 45 | IV |
| 74. | Solanum trifidum Correll | Mexico | PI 283064 | 24/2x/1 | Pinnatisecta | TRF64 | 40 | IV |
| 75. | Solanum trifidum Correll | Mexico | PI 283065 | 24/2x/1 | Pinnatisecta | TRF65 | 41 | IV |
| 76. | Solanum verrucosum Schltdl. | Mexico | PI 275255 | 24/2x/2 | Tuberosa | VER55 | 34 | II |
| 77. | Solanum verrucosum Schltdl. | Mexico | PI 275256 | 24/2x/2 | Tuberosa | VER56 | 39 | II |
| 78. | Solanum verrucosum Schltdl. | Mexico | PI 275257 | 24/2x/2 | Tuberosa | VER57 | 30 | II |
| 79. | Solanum verrucosum Schltdl. | Mexico | PI 275258 | 24/2x/2 | Tuberosa | VER58 | 35 | II |
| 80. | Solanum verrucosum Schltdl. | Mexico | PI 275259 | 24/2x/2 | Tuberosa | VER59 | 30 | II |
| 81. | Solanum verrucosum Schltdl. | Mexico | PI 275260 | 24/2x/2 | Tuberosa | VER60 | 25 | II |
| 82. | Solanum vernei Bitter & Wittm. | Argentina | PI 320330 | 24/2x/2 | Tuberosa | VRN30 | 21 | I |
aPotato gene bank IDs, starting with PI, CGN and CIP are obtained from Potato Introduction Station, NRSP-6, Sturgeon Bay, Wisconsin (USA); Centre for Genetic Resources, the Netherlands (CGN); and International Potato Centre, Lima, Peru, respectively
b‘Lab code’ was used in this study to denote the accessions on the cluster tree and images, due to space limitations
cTotal number of alleles of all 14 SSR markers scored in the accession
dAuthority of Solanum hannemanii is not available
Fig. 1.
Twenty-two wild potato (Solanum) species were used for SSR analysis. Due to space limitation on the image panel, accessions are mentioned here: Solanum acaule (CGN17938), S. berthaultii (PI 265858), S. cardiophyllum (PI 283062), S. chacoense (PI 197760), S. chomatophilum (PI 310990), S. hannemanii (CGN18001), S. hjertingii (PI 283103), S. hougasii (PI 161727), S. huancabambense (CGN18306), S. iopetalum (PI 275180), S. jamesii (CGN18346), S. lesteri (PI 558434), S. medians (PI 283081), S. microdontum (PI 195185), S. pinnatisectum (CGN17744), S. polyadenium (PI 230480), S. polytrichon (CGN17750), S. stenophyllidium (CGN17603), S. stoloniferum (PI 225661), S. trifidum (PI 255537), S. verrucosum (PI 275256), and S. vernei (PI 320330)
DNA analysis
Leaf tissues of 82 accessions were collected and total genomic DNA was isolated using the DNeasy® Plant Mini Kit (Qiagen, Venlo, Limburg, Netherlands) following manufacturer’s instructions. DNA quantification was performed with NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific, Wilmington, USA), and quality was checked on 1% (w/v) agarose gel for SSR analysis. Fourteen SSR markers (12 markers, one per chromosome from the PGI kit, Ghislain et al. 2009; and two polymorphic markers, STIKA and STU6SNRN, Provan et al. 1996) were used for polymerase chain reaction (PCR) amplification (Table 1). The PCR reaction was performed in 25 µL volume with DNA template (100 ng) in 1 × PCR buffer (2.5 mM/L MgCl2 and 200 µM/L dNTP), each primer (0.5 µM/L), and Taq polymerase (1U) (Qiagen, Venlo, Limburg, Netherlands) following initial denaturation at 94 °C/5 min; followed by 35 cycles of 94 °C/45 s, 51–60 °C/45 s, and 72 °C/1 min; and final extension at 72 °C/8 min in a Veriti Thermal Cycler (Life Technologies, Carlsbad, California, USA). The amplified SSR fragments were analysed with a 500-bp ‘GS 500 ROX’ standard on ‘3500 Genetic Analyzer’ using GeneMapper® Software Version 4.1 (Applied Biosystems, California, USA).
Data scoring and analysis
PCR reactions were repeated at least twice, and only reproducible, distinct, and scorable SSR alleles across the run were considered for analysis. A data matrix of 82 accessions was prepared on the basis of presence (1) or absence (0) of the alleles. Number of alleles, allele size, absolute frequencies and polymorphic information content (PIC) of markers were calculated for 82 samples. The PIC value of SSR markers was calculated according to the formula: , where Pi is the frequency of the ith allele of a marker detected in accessions (Nei 1973). A similarity matrix of SSR profiles was estimated based on the Dice similarity coefficient using the neighbour-joining clustering method using DARwin software with bootstrap value 100 (Perrier and Jacquemoud-Collet 2006). The principal component analysis (PCA) was analysed to assess the genetic association among the wild species using the software NTSYSpc (Rohlf 2006).
Results
SSR polymorphism
Allelic profiling of 82 accessions belonging to 22 wild potato species showed polymorphism using 14 SSR markers (Table 1). A summary of distribution of SSR alleles’ size, number of alleles, and PIC value is presented in Table 2. SSR analysis showed 109 alleles of 14 polymorphic SSR loci in wild species. The allele size ranged from a minimum of 104 bp (STI0030) to a maximum of 304 bp (STM5114). The number of alleles per marker ranged from 4 (STM5127/STM1053) to 13 (STM0019), whereas the PIC value varied between 0.66 (STM1053) and 0.91 (STM0019) (Table 3). The most informative SSR allele was 208 bp of STM1052, which amplified to maximum in 80 accessions, whereas 121 bp of STI0030 marker was found to be minimum in 3 accessions. A total of 2929 SSR alleles were amplified in all 82 accessions by 14 markers, which varied from 21 (VRN30) to 49 (PNT41) in the accessions. A dataset of SSR alleles was developed for all the accessions (Table 1 and Suppl. File S1). Several markers had either nil or very minor or non-scorable fragments shown as ‘Nil’ (null alleles) in Suppl. File S1.
Table 2.
Molecular profiling of wild potato species by SSR markers.
SSR markers source: Ghislain et al. (2009) (#1–12) and Provan et al. (1996) (#13–14)
| S. no. | SSR marker | Repeat motif | Sequence (5′ → 3′) | Map location | Alleles size (bp) | Number of alleles | Ta (°C) | PIC |
|---|---|---|---|---|---|---|---|---|
| 1 | STM5127 | (TCT)n |
F: TTCAAGAATAGGCAAAACCA R: CTTTTTCTGACTGAGTTGCCTC |
I | 237–247 | 4 | 55 | 0.74 |
| 2 | STM5114 | (ACC)n |
F: AATGGCTCTCTCTGTATGCT R: GCTGTCCCAACTATCTTTGA |
II | 275–304 | 6 | 60 | 0.80 |
| 3 | STM1053 | (TA)n (ATC)n |
F: TCTCCCCATCTTAATGTTTC R: CAACACAGCATACAGATCATC |
III | 165–180 | 4 | 53 | 0.66 |
| 4 | STI0012 | (ATT)n |
F: GAAGCGACTTCCAAAATCAGA R: AAAGGGAGGAATAGAAACCAAAA |
IV | 148–226 | 7 | 56 | 0.81 |
| 5 | STPoAc58 | (TA)n |
F: TTGATGAAAGGAATGCAGCTTGTG R: ACGTTAAAGAAGTGAGAGTACGAC |
V | 218–251 | 7 | 57 | 0.77 |
| 6 | STM0019a | (AT)n (GT)n (AT)n (GT)n (GC)n (GT)n |
F: AATAGGTGTACTGACTCTCAATG R: TTGAAGTAAAAGTCCTAGTATGTG |
VI | 108–247 | 13 | 55 | 0.91 |
| 7 | STM0031 | (AC)n…(AC)n GCAC (AC)n (GCAC)n |
F: CATACGCACGCACGTACAC R: TTCAACCTATCATTTTGTGAGTCG |
VII | 137–272 | 8 | 53 | 0.83 |
| 8 | STM1104 | (TCT)n |
F: TGATTCTCTTGCCTACTGTAATCG R: CAAAGTGGTGTGAAGCTGTGA |
VIII | 147–180 | 7 | 53 | 0.81 |
| 9 | STM1052 | (AT)n GT (AT)n (GT)n |
F: CAATTTCGTTTTTTCATGTGACAC R: ATGGCGTAATTTGATTTAATACGTAA |
IX | 141–300 | 10 | 55 | 0.77 |
| 10 | STM1106 | (ATT)n |
F: TCCAGCTGATTGGTTAGGTTG R: ATGCGAATCTACTCGTCATGG |
X | 124–294 | 11 | 51 | 0.87 |
| 11 | STM0037 | (TC)n (AC)n AA (AC)n (AT)n |
F: AATTTAACTTAGAAGATTAGTCTC R: ATTTGGTTGGGTATGATA |
XI | 130–289 | 10 | 52 | 0.85 |
| 12 | STI0030 | (ATT)n |
F: TTGACCCTCCAACTATAGATTCTTC R: TGACAACTTTAAAGCATATGTCAGC |
XII | 104–139 | 6 | 58 | 0.81 |
| 13 | STU6SNRN | (TGG)5 |
F: GAAGTTTTATCAGAATCC R: ATCACCTCATCAGCAATC |
– | 145–204 | 9 | 55 | 0.85 |
| 14 | STIKA | (T)12(A)9ATTCTTGTT(TA)2 CA(TA)7 |
F: TTCGTTGCTTACCTACTA R: CCCAAGATTACCACATTC |
– | 175–233 | 7 | 55 | 0.82 |
| Total | 109 | |||||||
PIC polymorphic information content, Ta annealing temperature
aAll SSR amplified at single locus except, STM019 amplifies at two loci (Ghislain et al. 2009)
Table 3.
Distribution of SSR allele size (bp) and its absolute frequency in wild potato species
| SSR primer | Allele size (absolute frequency) |
|---|---|
| STM5127 | 237 (43), 241 (40), 244 (25), 247 (37) |
| STM5114 | 275 (32), 281 (55), 284 (50), 287 (37), 290 (34), 304 (9) |
| STM1053 | 165 (65), 170 (78), 173 (28), 180 (11) |
| STI0012 | 148 (26), 161 (22), 167 (44), 194 (54), 199 (30), 205 (13), 226 (7) |
| STPoAc58 | 218 (47), 226 (59), 232 (23), 236 (21), 240 (13), 247 (9), 251 (5) |
| STM0019 | 108 (18), 118 (27), 126 (20), 145 (20), 156 (24), 162 (27), 166 (24), 172 (12), 180 (10), 189 (27), 195 (14), 206 (38), 247 (14) |
| STM0031 | 137 (35), 149 (40), 155 (12), 184 (9), 204 (14), 229 (37), 254 (12), 272 (18) |
| STM1104 | 147 (27), 151 (47), 154 (42), 160 (30), 164 (58), 171 (11), 180 (10) |
| STM1052 | 141 (24), 154 (5), 165 (4), 179 (10), 201 (38), 208 (80), 217 (8), 230 (6), 161 (13), 300 (12) |
| STM1106 | 124 (58), 127 (33), 130 (48), 139 (30), 146 (32), 155 (21), 169 (7), 182 (11), 235 (10), 268 (7), 294 (17) |
| STM0037 | 130 (17), 142 (10), 149 (10), 160 (19), 178 (47), 187 (18), 193 (15), 221 (7), 237 (13), 289 (7) |
| STI0030 | 104 (7), 109 (5), 115 (5), 121 (3), 135 (8), 139 (10) |
| STU6SNRN | 145 (16), 153 (31), 169 (22), 177 (36), 181 (69), 190 (78), 194 (41), 199 (66), 204 (20) |
| STIKA | 175 (21), 194 (64), 200 (54), 208 (62), 213 (33), 218 (17), 233 (29) |
Absolute frequency is the number of accessions in which the SSR amplified, out of total of 82 accessions used in the study. (e.g., absolute frequency will be a maximum of 82, if SSR amplified in all 82 accessions; and 0 if not amplified in any accession)
Cluster analysis
Cluster analysis of wild species distinguished all the accessions based on the Jaccard’s similarity coefficient (0.19–0.80) by 14 SSR markers (Fig. 2). All accessions were classified into major five clusters (I–V) based on the allelic profiles. Most accessions were categorised into the respective species cluster except a few like VRN30. Allelic variation was observed within the species. For example, accessions (BER25, BER58 and BER96) of S. berthaultii species were grouped into cluster II except BER57 (cluster III); S. jamesii and S. pinnatisectum species accessions were grouped into cluster III except JAM46, PNT42 and PNT43 (cluster I); S. trifidum accessions were grouped into cluster IV except TRF22 (cluster I). Genetic association in the wild species was shown by principal component analysis (PCA). The PCA analysis showed a total variance of 45.15% by calculating the first three components as 33.60, 6.67 and 4.87% and PCA plot showing the first two principal components (Dim-1 and Dim-2) is depicted in Suppl. File S2.
Fig. 2.
Diversity analysis of 82 accessions belonging to 22 wild species using 14 SSR markers based on the Dice coefficient using the weighted neighbour-joining tree construction method. Bootstrap values are shown on the nodes. Different colours are shown to represent the species
Discussion
We observed allelic variations in 82 accessions of 22 wild potato (Solanum) species by 109 alleles of 14 polymorphic SSR markers. All markers showed polymorphism based on the PIC values (0.66–0.91) distributed across the SSR loci in the accessions. SSR studies have shown good discrimination power and polymorphism in closely related potato species such as varietal identification (Powell et al. 1996) and characterization of wild species (Carputo et al. 2013). SSR allows labelling of genotypes to reveal genetic variation in potato (Ghislain et al. 2009) and germplasm management of reference collection (Reid et al. 2011). Our findings are congruent with earlier SSR studies on allelic variation including observation on null alleles (Provan et al. 1996; Ghislain et al. 2009) and validation of Andigena core collection (Tiwari et al. 2013). Allelic profiles in terms of size, number and absolute frequencies observed in this study showed little deviation in comparison with earlier findings (Provan et al. 1996; Ghislain et al. 2009). Probably, this could be due to the equipment types and software technologies used to analyse SSR alleles. We used a high-throughput fragment analysis system, i.e., ‘3500 Genetic Analyzer’ (Applied Biosystems) that has high precision, whilst earlier workers might have used a semi-automated gel-based method to score SSR alleles. Moreover, we used this system for molecular characterization of wild species and interspecific somatic hybrids (Sarkar et al. 2011; Chandel et al. 2015) and identification of potato varieties using SSR markers (Tiwari et al. 2018a). We observed null alleles in a few accessions with some SSR markers. Similar observations of null alleles have been reported earlier by Galarreta et al. (2011) on characterization of potato landraces and by Tiwari et al. (2013) on characterization of Andigena core collection.
Our earlier study showed high allelic diversity with a range of PIC values (0.53–0.92) using SSR markers in characterization of Indian potato varieties (Tiwari et al. 2018a). Similarly, high SSR allelic diversity has also been reported in potato landraces by Galarreta et al. (2011). Researchers have suggested that SSR markers are a useful tool to investigate genetic variations in closely related taxa of potato (Solanum tuberosum subsp. tuberosum and subsp. andigenum) due to allelic polymorphism and high degree of heterozygosity in microsatellite regions (Raker and Spooner 2002). Cluster and PCA analysis in this study using 14 SSR markers reflected genetic distinctness among the accessions of the wild species. Cluster analysis showed the maximum value of Jaccard’s similarity coefficients to be 0.80 by 14 SSR to distinguish the accessions. An SSR database of potato varieties of the European Union common catalogue has been developed showing unique profiles (Reid et al. 2011). We developed a dataset of SSR markers for identification of potato varieties (Tiwari et al. 2018a). Thus, the above studies show the versatility of the SSR system for molecular characterization of potatoes.
South America is the centre of origin of potato and the Solanum species originated from the Andean regions of Peru, Bolivia and Argentina in South America and Mexico/Central America (Hawkes 1990). Distinct variations have been observed in this study by SSR markers within the species and between/among the accessions with respect to allelic distribution, which could be due to genomic changes during evolutionary process of the species (Provan et al. 1996). In potato, since each TPS is genetically different from another TPS, allelic variation could be expected among the accessions and within the species. Diversity based on the SSR alleles has been observed in the accessions irrespective of the origin country, series and species. The 82 accessions used in this study originated mostly from Mexico (61) followed by Argentina (7), Bolivia (5), the United States of America (5) and Peru (4). Interestingly, the wild species that originated from South American countries like Argentina (S. acaule, S. chacoense, S. hannemanii, S. microdontum and S. vernei) and Peru (S. chomatophilum, S. huancabambense and S. medians) have been grouped into cluster I. On the contrary, Mexico-originated species (S. cardiophyllum, S. hjertingii, S. hougasii, S. iopetalum, S. lesteri, S. pinnatisectum, S. polyadenium, S. polytrichon, S. stenophyllidium, S. stoloniferum, S. trifidum, and S. verrucosum) have been grouped differently into all five clusters, whereas Bolivia (S. acaule and S. berthaultii) and the United States of America (S. jamesii) species have been grouped into various clusters.
To conclude, allelic profiling of wild potato species by SSR markers, development of a dataset of alleles and diversity among the accessions of the species are important information for future application of these species. These wild species are an important resource of resistance genes for various biotic and abiotic stresses and could be characterized for more traits like late blight resistance (Tiwari et al. 2015). Future study should be focused on the identification of SSR alleles linked to target traits and their deployment in future improvement programmes applying breeding and biotechnological approaches.
Electronic supplementary material
Below is the link to the electronic supplementary material.
Acknowledgements
The authors thank the Competent Authority, ICAR-CPRI, Shimla; Germplasm and Biotechnology programmes (HORTCPRICIL201500300131); and CABin scheme (IASRI, New Delhi) for necessary support. Special thanks to Mr. Sheeshram Thakur for in vitro maintenance of wild species, and Mr. CM Bist for SSR analysis. The International GenBank are gratefully acknowledged for providing the TPS of the wild species.
Author contributions
JKT designed the experiment. JKT, NL, SD and RZ performed the SSR analysis. VK provided the samples. JKT analysed the data and wrote the manuscript, and SKC edited it. All authors read and confirmed the manuscript.
Compliance with ethical standards
Conflict of interest
The authors declare that there is no conflict of interest.
References
- Bradshaw JE, Bryan GJ, Ramsay G. Genetic resources (including wild and cultivated Solanum species) and progress in their utilisation in potato breeding. Potato Res. 2006;49:49–65. doi: 10.1007/s11540-006-9002-5. [DOI] [Google Scholar]
- Carputo D, Alioto D, Aversano R, Garramone R, Miraglia V, Villano C, Frusciante L. Genetic diversity among potato species as revealed by phenotypic resistances and SSR markers. Plant Genet Resour Character Utiliz. 2013;11:131–139. doi: 10.1017/S1479262112000500. [DOI] [Google Scholar]
- Chakrabarti SK, Conghua X, Tiwari JK. The potato genome. Basel: Springer; 2017. [Google Scholar]
- Chandel P, Tiwari JK, Ali N, Devi S, Sharma SH, Sharma SA, Luthra SK, Singh BP. Interspecific potato somatic hybrids between Solanum tuberosum and S. cardiophyllum, potential sources of late blight resistance breeding. Plant Cell Tiss Organ Cult. 2015;123:579–589. doi: 10.1007/s11240-015-0862-8. [DOI] [Google Scholar]
- Galarreta JIR, Barandalla L, Rios DJ, Lopez R, Ritter E. Genetic relationships among local potato cultivars from Spain using SSR markers. Genet Resour Crop Evol. 2011;58:383–395. doi: 10.1007/s10722-010-9583-3. [DOI] [Google Scholar]
- Ghislain M, Nuñez J, Herrera MR, Pignataro J, Guzmán N, Bonierbale M, Spooner DM. Robust and highly informative microsatellite-based genetic identity kit for potato. Mol Breed. 2009;23:377–388. doi: 10.1007/s11032-008-9240-0. [DOI] [Google Scholar]
- Gopal J, Kumar V, Sandhu SK. Biosystematics and genetic resources of potato. In: Khurana SMP, Minhas JS, Pandey SK, editors. The potato production and utilization in subtropics. New Delhi: Mehta Publishers; 2003. pp. 31–47. [Google Scholar]
- Hawkes JG. The potato: evolution, biodiversity and genetic resources. Washington, DC: Belhaven Press; 1990. [Google Scholar]
- Hijmans RJ, Spooner DM. Geographic distribution of wild potato species. Am J Bot. 2001;88:2101–2112. doi: 10.2307/3558435. [DOI] [PubMed] [Google Scholar]
- Liao H, Guo H. Using SSR to evaluate the genetic diversity of potato cultivars from Yunnan province (SW China) Acta Biol Cracov Ser Bot. 2014;56(1):16–27. [Google Scholar]
- Machida-Hirano R, Niino T. Potato genetic resources. In: Chakrabarti SK, Conghua X, Tiwari JK, editors. The potato genome. Basel: Springer; 2017. pp. 11–30. [Google Scholar]
- Nei M. Analysis of gene diversity in subdivided populations. Proc Natl Acad Sci USA. 1973;70:3321–3323. doi: 10.1073/pnas.70.12.3321. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Perrier X, Jacquemoud-Collet JP (2006) DARwin software. http://darwin.cirad.fr/darwin. Accessed 30 Apr 2019
- Powell W, Morgante M, Andre C, Hanafey M, Vogel MJ, Tingey SV, Rafalski A. The comparison of RFLP, RAPD, AFLP and SSR (microsatellites) markers for germplasm analysis. Mol Breed. 1996;2:225–235. doi: 10.1007/BF00564200. [DOI] [Google Scholar]
- Provan J, Powell W, Waugh R. Microsatellite analysis of relationships within cultivated potato (Solanum tuberosum) Theor Appl Genet. 1996;92:1078–1084. doi: 10.1007/BF00224052. [DOI] [PubMed] [Google Scholar]
- Raker CM, Spooner DM. Chilean tetraploid cultivated potato, Solanum tuberosum, is distinct from the Andean populations: microsatellite data. Crop Sci. 2002;42:1451–1458. doi: 10.2135/cropsci2002.1451. [DOI] [Google Scholar]
- Reid A, Hof L, Felix G, Rücker B, Tams S, Milczynska E, Esselink D, Uenk G, Vosman B, Weitz A. Construction of an integrated microsatellite and key morphological characteristic database of potato varieties on the EU common catalogue. Euphytica. 2011;182:239–249. doi: 10.1007/s10681-011-0462-6. [DOI] [Google Scholar]
- Rohlf F. NTSYSpc: numerical taxonomy system (ver. 2.2) Setauket: Exeter Publishing, Ltd.; 2006. [Google Scholar]
- Sarkar D, Tiwari JK, Sharma S, Poonam Sharma Sanjeev, Gopal J, Singh BP, Luthra SK, Pandey SK, Pattanayak D. Production and characterization of somatic hybrids between Solanum tuberosum L. and S. pinnatisectum Dun. Plant Cell Tiss Organ Cult. 2011;107:427–440. doi: 10.1007/s11240-011-9993-8. [DOI] [Google Scholar]
- Tiwari JK, Singh BP, Gopal J, Poonam Patil VU. Molecular characterization of the Indian Andigena potato core collection using microsatellite markers. Afr J Biotechnol. 2013;12:1025–1033. [Google Scholar]
- Tiwari JK, Devi S, Sharma S, Chandel P, Rawat S, Singh BP. Allele mining in Solanum germplasm: cloning and characterization of RB-homologous gene fragments from late blight resistant wild potato species. Plant Mol Biol Rep. 2015;33:1584–1598. doi: 10.1007/s11105-015-0859-9. [DOI] [Google Scholar]
- Tiwari JK, Kumar V, Devi S, Luthra SK, Chakrabarti SK, Rawat S, Nagesh M. Genomics in management and genetic enhancement of potato germplasm. In: Chakrabarti SK, Conghua X, Tiwari JK, editors. The potato genome. Basel: Springer; 2017. pp. 123–142. [Google Scholar]
- Tiwari JK, Ali N, Devi S, Kumar V, Zinta R, Chakrabarti SK. Development of microsatellite markers set for identification of Indian potato varieties. Sci Hort. 2018;231:22–30. doi: 10.1016/j.scienta.2017.11.027. [DOI] [Google Scholar]
- Tiwari JK, Devi S, Ali N, Luthra SK, Kumar V, Bhardwaj V, Singh RK, Rawat S, Chakrabarti SK. Progress in somatic hybridization research in potato during the past 40 years. Plant Cell Tiss Organ Cult. 2018;132:225–238. doi: 10.1007/s11240-017-1327-z. [DOI] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.


