KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Phospho-S6 Ribosomal Protein (Ser240/244) Antibody | Cell Signaling Technology | 2215BF |
| Anti-digoxigenin-POD | Roche | 11207733910 |
| Anti-fluorescein-POD | Roche | 11426346910 |
| Anti-DNP-HRP | Perkin Elmer | FP1129 |
| Anti-rabbit IgG HRP-linked antibody | Cell Signaling Technology | 7074P2 |
| Rabbit anti-HBB (, PA5–48233) | Invitrogen | PA5–48233 |
| Donkey anti-rabbit Alexa555 conjugate | Invitrogen | A-31572 |
| Streptavidin-Alexa488 conjugate | Invitrogen or Jackson ImmunoResearch | S11223 or 016–540-084 |
| Bacterial and Virus Strains | ||
| E. coli Rosetta BL2 (DE3) | Novagen | 70954 |
| Biological Samples | ||
| Vmn2r65 targeted null mice | This paper | |
| Vmn2r88 targeted null mice | This paper | |
| Vmn2r65/Vmn2r88 targeted null mice | This paper | |
| Chemicals, Peptides, and Recombinant Proteins | ||
| FLAG (DYKDDDDK) peptide | Genscript | RP10586 |
| T7 RNA polymerase | New England Biolabs or Promega | M0251S/L or P2075 |
| Sp6 RNA polymerase | New England Biolabs or Promega | M0207S/L or P1085 |
| T3 RNA polymerase | Promega | P2083 |
| NBT/BCIP | Promega | S3771 |
| Dig RNA labeling mix | Roche | 11277073910 |
| Fluorescein RNA labeling mix | Roche | 11685619910 |
| DNP-11-UTP | Perkin Elmer | NEL555001EA |
| Magnetic protein A dynabeads | Invitrogen | 10001D |
| Critical Commercial Assays | ||
| TSA plus biotin kit | Perkin Elmer | NEL749A001KT |
| TSA plus Cy3 kit | Perkin Elmer | NEL744001KT |
| SMARTer Ultra Low Input RNA for Illumina Sequencing - HV | Clontech | 634826 |
| Low Input Library Prep Kit | Clontech | 634947 |
| Deposited Data | ||
| M. musculus reference genome mm10 | Ensembl | ftp://ftp.ensembl.org/pub/release-73/fasta/mus_musculus/dna/ |
| RNA-seq raw and analyzed data | This study | GEO: GSE122138 |
| Experimental Models: Cell Lines | ||
| Experimental Models: Organisms/Strains | ||
| Mus musculus, C57BL6/J | The Jackson Laboratory | Stock No:000664 |
| Mus musculus, 129S1/SvImJ | The Jackson Laboratory | Stock No:002448 |
| Mus musculus, CD-1 | Charles River | N/A |
| Mus musculus, TrpC2+/- | Stowers et al. 2002 | Trpc2tm1Dlc |
| Oligonucleotides | ||
| Vmn2r65 wild type genotyping primer, forward CTTCATAGCGTTTTTGCCTTC | This study | N/A |
| Vmn2r65 wild type genotyping primer, reverse TGAGAAGTCGGTTATTCGCC | This study | N/A |
| Vmn2r65 mutant genotyping primer, forward TAACGGTCCTAAGGTAGCGA | This study | N/A |
| Vmn2r65 mutant genotyping primer, reverse TCACCCTGAATGCAGGTGTA | This study | N/A |
| Vmn2r88 wild type genotyping primer, forward GTTTTGTTTGATCAGAAACATAGGTTAATAC | This study | N/A |
| Vmn2r88 wild type genotyping primer, reverse AGTTCTGTCCTGTTTGTAAGTTCAAATTTGT | This study | N/A |
| Vmn2r88 mutant genotyping primer, forward TAACGGTCCTAAGGTAGCGA | This study | N/A |
| Vmn2r88 mutant genotyping primer, reverse TTTTGGTTGAGGACTGGAGT | This study | N/A |
| Recombinant DNA | ||
| pET28a-hbb-bt-SD-hba-a1-his | This study | N/A |
| pET28a-his-smgc-flag | This study | N/A |
| Software and Algorithms | ||
| RNA STAR 2.3.1 | Dobin et al. 2013 | https://github.com/alexdobin/STAR |
| DESeq2 | Love et al. 2014 | https://bioconductor.org/packages/release/bioc/html/DESeq2.html |
| Rstudio | https://www.rstudio.com/ | RRID:SCR_000432 |
| R | http://www.r-project.org/ | RRID: SCR_001905 |
| Fiji | http://fiji.sc | RRID: SCR_002285 |
| Samtools | http://samtools.sourceforge.net/ | RRID:SCR_002105 |
| Prism 5 | Graphpad | N/A |
| Observer XT 14 | Noldus | N/A |
| Other | ||
| Body Double Standard Set | Smooth-On | N/A |