Skip to main content
. Author manuscript; available in PMC: 2019 Dec 13.
Published in final edited form as: Cell. 2018 Dec 13;175(7):1827–1841.e17. doi: 10.1016/j.cell.2018.11.032

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
Phospho-S6 Ribosomal Protein (Ser240/244) Antibody Cell Signaling Technology 2215BF
Anti-digoxigenin-POD Roche 11207733910
Anti-fluorescein-POD Roche 11426346910
Anti-DNP-HRP Perkin Elmer FP1129
Anti-rabbit IgG HRP-linked antibody Cell Signaling Technology 7074P2
Rabbit anti-HBB (, PA5–48233) Invitrogen PA5–48233
Donkey anti-rabbit Alexa555 conjugate Invitrogen A-31572
Streptavidin-Alexa488 conjugate Invitrogen or Jackson ImmunoResearch S11223 or 016–540-084
Bacterial and Virus Strains
E. coli Rosetta BL2 (DE3) Novagen 70954
Biological Samples
Vmn2r65 targeted null mice This paper
Vmn2r88 targeted null mice This paper
Vmn2r65/Vmn2r88 targeted null mice This paper
Chemicals, Peptides, and Recombinant Proteins
FLAG (DYKDDDDK) peptide Genscript RP10586
T7 RNA polymerase New England Biolabs or Promega M0251S/L or P2075
Sp6 RNA polymerase New England Biolabs or Promega M0207S/L or P1085
T3 RNA polymerase Promega P2083
NBT/BCIP Promega S3771
Dig RNA labeling mix Roche 11277073910
Fluorescein RNA labeling mix Roche 11685619910
DNP-11-UTP Perkin Elmer NEL555001EA
Magnetic protein A dynabeads Invitrogen 10001D
Critical Commercial Assays
TSA plus biotin kit Perkin Elmer NEL749A001KT
TSA plus Cy3 kit Perkin Elmer NEL744001KT
SMARTer Ultra Low Input RNA for Illumina Sequencing - HV Clontech 634826
Low Input Library Prep Kit Clontech 634947
Deposited Data
M. musculus reference genome mm10 Ensembl ftp://ftp.ensembl.org/pub/release-73/fasta/mus_musculus/dna/
RNA-seq raw and analyzed data This study GEO: GSE122138
Experimental Models: Cell Lines
Experimental Models: Organisms/Strains
Mus musculus, C57BL6/J The Jackson Laboratory Stock No:000664
Mus musculus, 129S1/SvImJ The Jackson Laboratory Stock No:002448
Mus musculus, CD-1 Charles River N/A
Mus musculus, TrpC2+/- Stowers et al. 2002 Trpc2tm1Dlc
Oligonucleotides
Vmn2r65 wild type genotyping primer, forward CTTCATAGCGTTTTTGCCTTC This study N/A
Vmn2r65 wild type genotyping primer, reverse TGAGAAGTCGGTTATTCGCC This study N/A
Vmn2r65 mutant genotyping primer, forward TAACGGTCCTAAGGTAGCGA This study N/A
Vmn2r65 mutant genotyping primer, reverse TCACCCTGAATGCAGGTGTA This study N/A
Vmn2r88 wild type genotyping primer, forward GTTTTGTTTGATCAGAAACATAGGTTAATAC This study N/A
Vmn2r88 wild type genotyping primer, reverse AGTTCTGTCCTGTTTGTAAGTTCAAATTTGT This study N/A
Vmn2r88 mutant genotyping primer, forward TAACGGTCCTAAGGTAGCGA This study N/A
Vmn2r88 mutant genotyping primer, reverse TTTTGGTTGAGGACTGGAGT This study N/A
Recombinant DNA
pET28a-hbb-bt-SD-hba-a1-his This study N/A
pET28a-his-smgc-flag This study N/A
Software and Algorithms
RNA STAR 2.3.1 Dobin et al. 2013 https://github.com/alexdobin/STAR
DESeq2 Love et al. 2014 https://bioconductor.org/packages/release/bioc/html/DESeq2.html
Rstudio https://www.rstudio.com/ RRID:SCR_000432
R http://www.r-project.org/ RRID: SCR_001905
Fiji http://fiji.sc RRID: SCR_002285
Samtools http://samtools.sourceforge.net/ RRID:SCR_002105
Prism 5 Graphpad N/A
Observer XT 14 Noldus N/A
Other
Body Double Standard Set Smooth-On N/A