KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Mouse anti-FLAG M2 | Sigma-Aldrich | Cat#F1804 RRID:AB_262044 |
| Rabbit anti-His-tag | Cell Signaling Technology | Cat#2365S RRID:AB_2115720 |
| Myc-antibody | R&D systems | Cat#AF3696 RRID:AB_2282405 |
| Rabbit anti-AGO2 | Cell Signaling Technology | Cat#2897 RRID:AB_2096291 |
| ALG-1 antibody | Invitrogen | Cat#PA1-031 RRID:AB_2539852 |
| Rabbit anti-GW182 (for immunoblotting) | Novus Biologicals | Cat#NBP1-57134 RRID:AB_11008641 |
| Goat anti-DAF16 antibody | Santa Cruz Biotechnology | Cat#SC-9229 RRID:AB_671895 |
| eNOS antibody | Santa Cruz Biotechnology | Cat#SC-654 RRID:AB_631423 |
| β-actin antibody | Sigma-Aldrich | Cat#A1978 RRID:AB_476692 |
| Anti-GW182 antibody (for immunoprecipitation) | Novus Biologicals | Cat#NBP1-28751 RRID:AB_2207020 |
| GAPDH antibody | Abcam | Cat#ab181602 RRID:AB_2630358 |
| β-arrestin2 antibody | Cell Signaling Technology | Cat#3857 RRID:AB_2258681 |
| AIN-1 antibody | Alessi et al., 2015(Gift of John K. Kim, Johns Hopkins University) | N/A |
| Antibiotic-Antimycotic | Life Technologies | Cat#15240-062 |
| DMEM | Life Technologies | Cat#11965-092 |
| Fetal Bovine Serum | Sigma-Aldrich | Cat#F4135 |
| Bacterial and Virus Strains | ||
| B. subtilis 1A1 | BGSC, Ohio State University | BGSCID: 1A1 |
| B. subtilis 1A1 (∆nos) | BGSC, Ohio State University | BGSCID: BKE07630 |
| E. coli strain BW25113 WT | CGSC, Yale | CGSC#7636 |
| E. coli strain BW25113 ∆narG | CGSC, Yale | CGSC#11789 |
| Biological Samples | ||
| Chemicals, Peptides, and Recombinant Proteins | ||
| DETA-NONOate | Cayman Chemicals | Cat#82120 |
| Purified Cas9 | New England Biolabs | Cat#M0386 |
| tracrRNA | Dharmacon | Cat#U-002005 |
| DPTA-NONOare | Cayman Chemicals | Cat#82110 |
| QIAzol lysis reagent | QIAGEN | Cat#79306 |
| IP lysis buffer | Thermo Scientific | Cat#87788 |
| Protease Inhibitor Cocktail tablets | Roche | Cat#04693159001 |
| Critical Commercial Assays | ||
| SilverQuest silver staining kit | Invitrogen | Cat#LC6070 |
| Imperial Protein Stain | ThermoFisher Scientific | Cat#24615 |
| Dual-Luciferase Reporter Assay System | Promega | Cat#E1910 |
| pre-cast 4-20% SDS-PAGE gels | Bio-Rad Laboratories | Cat#3450033 |
| Protein A/G Agarose | Pierce, ThermoScientific | Cat#20421 |
| Lipofectamine® 2000 | ThermoScientific | Cat#11668027 |
| Lipofectamine RNAi Max | Invitrogen | Cat#13778075 |
| SuperSignal® West Femto Maximum Sensitivity Substrate | ThermoScientific | Cat#34095 |
| PolyJet reagent | SignaGen Laboratories | Cat#SL100688 |
| Deposited Data | ||
| Structure of human Argonaute-1 in complex with the hook motif of human GW182 | Elkayam et al., 2017 | PDB:5W6V |
| Experimental Models: Cell Lines | ||
| HEK293 Cells | ATCC | Cat#CRL-1573 |
| HeLa cells | ATCC | Cat#CCL-2 |
| Experimental Models: Organisms/Strains | ||
| C. elegans wild isolate (C. elegans var Bristol) | Caenorhabditis Genetics Center | Cat#N2 |
| C. elegans let-7(n2853) | Caenorhabditis Genetics Center | Cat#MT7626 |
| C. elegans C855S let-7(n2853) | This study | N/A |
| Oligonucleotides | ||
| Human Ago2 cloning F: 5’GACTGAACATATGTACTCGGGAGCCGGCCCCGCACTTGCACC 3’ | This study | Life Technologies |
| Human Ago2 cloning R: 5’TATCGTACAAGCTTAGCAAAGTACATGGTGCGCAGAGTGTCTTGG 3’ | This study, Life Technologies | N/A |
| Ago2 C691S F: 5’ GCTGGCCATCCGTGAGGCCAGTATCAAGC 3’ | This study, Life Technologies | N/A |
| Ago2 C691S R: 5’ GCTTGATACTGGCCTCACGGATGGCCAGC 3’ | This study, Life Technologies | N/A |
| TracerRNA: 5’AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU 3’ | This study, Dharmacon | N/A |
| CrRNA alg-1: 5’ TGAGCTTCGCGCGATTCGCG 3’ +5’ GUUUUAGAGCUAUGCUGUUUUGUUU 3’ | This study, Dharmacon | N/A |
| CrRNA dpy-10: 5‘ GCUACCAUAGGCACCACGAG 3’ +5’ GUUUUAGAGCUAUGCUGUUUUG 3’ | This study, Dharmacon | N/A |
| Non-targeting control siRNA pool | ThermoScientific: | Cat#D-001810-10-05 |
| β-arrestin2 specific siRNA pool Mission esiRNA | Sigma-Aldrich: | Cat#EHU069991 |
| Recombinant DNA | ||
| pET21b | Novagen | Cat#69741 |
| pET21b-AGO2-His | This study | N/A |
| FLAG-AGO2 | Lian et al., 2009 | Addgene Plasmid #21538 |
| Hmga2 3’UTR WT luciferase | Mayr et al., 2007 | Addgene Plasmid #14785 |
| Hmga2 3’UTR m7 luciferase | Mayr et al., 2007 | Addgene Plasmid #14788 |
| pcDNA myc tagged AGO-2 | Liu et al, 2005(Gift of Greg Hannon, CSHL) | N/A |
| Software and Algorithms | ||
| PyMol 2.0 | Pymol | https://pymol.org/2/ |
| ImageJ | NIH | https://imagej.nih.gov/ij/ |
| Other | ||