Table 1.
TRG nt sequence alignments
| Gene | V | J | CDR3 nt sequence | CDR3 amino acid sequence | Percentage of all CDR3 nt sequences | |||
| LN day 0 | LN day 28 | Skin day 0* | Skin day 7* | |||||
| TRG | V6 | J1 | tgtgcatgctgggatagctcaggttttcacaaggtattt | CACWDSSGFHKVF | 2.8 | 21.1 | 0 | 4.6 |
| TRG | V5 | J1 | tgtgcctgctgggatagctcaggttttcacaaggtattt | CACWDSSGFHKVF | 0.7 | 0.9 | 15.7 | 6.9 |
| TRD | V4 | J2 | tgtgggtcagatatcggagggagctcctgggacacccgacagatgtttttt | CGSDIGGSSWDTRQMFF | 1.6 | 30.0 | 3.8 | 10.9 |
TRGV6, TRGV5, and TRDV4 CDR3 nucleotide sequences, gene sequence alignments (underlining indicates nucleotide differences), and respective encoded CDR3 amino acid sequences of the different clonotypes from the TRG6, TRG5, and TRD4 CDR3 reads in Fig. 5A and Brady et al. (52). The percentage of each of the specific TRGV6, TRGV5, or TRDV4 CDR3 nt sequences of the total number of reads of all respective TRGV6, TRGV5, or TRDV4 CDR3 nt sequences is shown for lymph node (LN) specimens from days 0 (naïve) and 28 as well as for skin specimens of S. aureus-infected skin from days 0 and 7 from Brady et al. (52).
*
Brady et al. (52).