Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background | E. coli BL21(DE3) | New England Biolabs | Cat#C2527 | |
| Cell line (Homo sapiens) | Hela cells | ATCC | RCB0007 | |
| Cell line (Homo sapiens) | U2OS cells | STRV | ||
| Cell line (Homo sapiens) | U2OS cells stably expressing eYFP-53BP1 WT, S366A and T670A | This study | ||
| Cell line (Homo sapiens) | RPE-1 htert WT | STRV | ||
| Transfected construct | peYFP-53BP1 WT, peYFP-53BP1 S366A, peYFP-53BP1 T670A, peYFP-53BP1 S366A T670A | This study | ||
| Antibody | Mouse monoclonal anti-GFP [LGB-1] | Abcam | Cat#ab291, RRID:AB_449092 | (1:100) dilution IF |
| Antibody | Rabbit monoclonal anti-pATM (S1981) | Abcam | Cat#2152–1 RRID:AB_991678 lot GR217573-12 | (1:100) dilution IF |
| Antibody | Donkey polyclonal anti-goat Alexa Fluor 647 | Abcam | Cat#ab150135 RRID:AB_2687955 | (1:400) dilution IF |
| Antibody | Goat polyclonal anti-53BP1 | Bethyl Laboratories, Inc | Cat#A303-906A RRID:AB_2620256 |
(1:100) dilution IF |
| Antibody | Rabbit polyclonal anti-53BP1 | Bethyl Laboratories, Inc | Cat#A300-272A RRID:AB_185520 |
(1:100) dilution IF |
| Antibody | Rabbit polyclonal anti-Rad9 | Bethyl Laboratories, Inc | Cat#A300-890A RRID:AB_2269209 | (1:100) dilution IF |
| Antibody | Rabbit polyclonal anti-TopBP1 | Bethyl Laboratories, Inc | Cat#A300-111A RRID:AB_2272050 | (1:50) dilution IF, (1:500) dilution WB |
| Antibody | Rabbit polyclonal anti-β-actin (13E5) | Cell Signaling Technology | Cat#4970 also 4970P,4970L,4970S RRID:AB_2223172 lot 14 | (1:1000) dilution WB |
| Antibody | Mouse monoclonal anti-p53 (DO-7) | Cell Signaling Technology | Cat# 48818 RRID:AB_2713958 lot 1 | (1:100) dilution IF |
| Antibody | Rabbit polyclonal anti-p-p53 (S15) | Cell Signaling Technology | Cat#9284also9284S,9284L,9284P RRID:AB_331464 lot 19 | (1:100) dilution IF |
| Antibody | Rabbit monoclonal anti-p21 Waf1/Cip1 (12D1) | Cell Signaling Technology | Cat#2947also2947S,2947P RRID:AB_823586 lot 9 | (1:100) dilution IF |
| Antibody | Goat polyclonal anti-mouse IgG Fab2 Alexa Fluor 647 Molecular Probes | Cell Signaling Technology |
Cat#4410S RRID:AB_10694714 lot 11 | (1:400) dilution IF |
| Antibody | Goat anti-rabbit IgG, HRP linked Antibody | Cell Signaling Technology | Cat#7074also7074S, 7074V,7074P2 RRID:AB_2099233 lot 26 |
(1:2000) dilution WB |
| Antibody | Goat anti-mouse IgG, HRP linked Antibody | Cell Signaling Technology | Cat#7076also7076S,7076V,7076P2 RRID:AB_330924 lot 32 | (1:2000) dilution WB |
| Antibody | Mouse monoclonal anti-53BP1 | EMD Millipore Corp |
Cat#MAB3802 RRID:AB_2206767 lot 2794909 |
(1:500) dilution IF, (1:500) dilution WB |
| Antibody | Rabbit polyclonal anti-pATR (pT1989) | GeneTex | Cat#GTX128145 RRID:AB_2687562 | (1:100) dilution IF, (1:500) dilution WB |
| Antibody | Rabbit polyclonal anti-pS366 53BP1 | ImmunoKontact | Antigen:[CSSDLVAP(pS)PDAFRSTP] | (1:500) dilution IF, (1:500) dilution WB |
| Antibody | Rabbit polyclonal anti-pT670 53BP1 | ImmunoKontact | Antigen:[CVEEIPE(pT)PCESQGEE] | (1:500) dilution IF, (1:500) dilution WB |
| Antibody | Mouse monoclonal anti-BrdU Monoclonal Antibody (MoBU-1), Alexa Fluor 488 | Invitrogen by ThermoFisher Scientific |
Cat#B35130 RRID:AB_2536434 lot 1712859 | (1:200) dilution IF |
| Antibody | Donkey polyclonal anti-rabbit DKXRB TRITC | Invitrogen by ThermoFisher Scientific |
Cat#A16040 RRID:AB_2534714 lot 31-33-091912 | (1:400) dilution IF |
| Antibody | Donkey polyclonal anti-mouse DKXMU IgG F(AB)’ 2 FITC | Invitrogen by ThermoFisher Scientific | Cat#A24507 RRID:AB_2535976 lot 42-73-052014 | (1:400) dilution IF |
| Antibody | Goat polyclonal anti-rabbit IgG (H + L) Cross-Adsorbed Goat Secondary Antibody, Cyanine5 | Invitrogen by ThermoFisher Scientific |
Cat#A10523 RRID:AB_10374302 lot1675037 | (1:400) dilution IF |
| Antibody | Mouse monoclonal anti-Cyclin A (B-8) | Santa Cruz Biotechnology | Cat#sc-271682 RRID:AB_10709300 lot L1316 | (1:100) dilution IF |
| Antibody | Goat polyclonal anti-ATR (N-19) | Santa Cruz Biotechnology | Cat#sc-1887 RRID:AB_630893 lot G1408 | (1:500) dilution WB |
| Antibody | Rabbit polyclonal anti-HA-probe (Y-11) | Santa Cruz Biotechnology |
Cat#sc-805 RRID:AB_631618 lot C0415 | (1:100) dilution IF, (1:2000) dilution WB |
| Antibody | Mouse monoclonal anti-HA-probe (F-7) | Santa Cruz Biotechnology | Cat#sc-7392 RRID:AB_627809 lot C1114 | (1:100) dilution IF |
| Antibody | Rabbit polyclonal anti-Tubulin (H-235) | Santa Cruz Biotechnology |
Cat#sc-9104 RRID:AB_2241191 lot L1713 | (1:2000) dilution WB |
| Recombinant DNA reagent | Plasmid: pCMH6K HA-53BP1 | Noon et al., 2010 a gift from Penny Jeggo | N/A | Plasmid encoding full length Human 53BP1 WT, S366A, T670A or S366A T670A mutants. Contains silent mutations for siRNA resistance. |
| Recombinant DNA reagent | Plasmid: peYFP-53BP1 | This paper | N/A | Plasmid encoding full length Human 53BP1 WT, S366A, T670A or S366A T670A mutants. Contains silent mutations for siRNA resistance. |
| Recombinant DNA reagent | Plasmid: peYFP-C1 | N/A | ||
| Sequence-based reagent | siRNA targeting sequence: SCR siRNA: sense: UUCAAUAAAUUCUUGAGGU(dTdT) antisense: (dTdT) CCTCAAGAATTTATTGAA | Eurofins (Lou et al., 2003) | ||
| Sequence-based reagent | siRNA targeting sequence: 53BP1 siRNA*: sense: AGAACGAGGAGACGGUAAUAGUGGG(dTdT) antisense: (dTdT)CCCACTATTACCGTCTCCTCGTTCT | Eurofins (Noon et al., 2010) | ||
| Sequence-based reagent | siRNA targeting sequence: 3’ UTR 53BP1 siRNA**: sense: AAAUGUGUCUUGUGUGUAA(dTdT) antisense: (dTdT)TTACACACAAGACACATTT | Eurofins (Knobel et al., 2014) | ||
| Sequence-based reagent | siRNA targeting sequence: TOPBP1 : sense: GUAAAUAUCUGAAGCUGUA(dTdT) antisense: (dTdT) UACAGCUUCAGAUAUUUAC | Eurofins (Broderick et al., 2015) |
||
| Sequence-based reagent | siRNA targeting: ATR siRNA ID: s536 | ThermoFisher Scientific | ||
| Sequence-based reagent | Primer: 53BP1 cloning fragment 1 Forward (5’- > 3’): GTCCGGACTCAGATCTATGGACCCTACTG GAAGTCAGT |
Eurofins (this paper) | Primer used for PCR in cloning experiment |
|
| Sequence-based reagent | Primer: 53BP1 cloning fragment 1 Reverse (5’- > 3’): CACACTGGCGTCCCTGTCTGACTGACC | Eurofins (this paper) | Primer used for PCR in cloning experiment | |
| Sequence-based reagent | Primer: 53BP1 cloning fragment 2 Forward (5’- > 3’): AGGGACGCCAGTGTGTGAGGAGGATGGT | Eurofins (this paper) | Primer used for PCR in cloning experiment | |
| Sequence-based reagent | Primer: 53BP1 cloning fragment 2 Reverse (5’- > 3’): TAGATCCGGTGGATCCTTAGTGAGAAACATAATCGTGTTTATATTTTGGATGCT | Eurofins (this paper) | Primer used for PCR in cloning experiment | |
| Sequence-based reagent | Primer: 53BP1 S366A mutagenesis Forward (5’- > 3’): TTGTTGCTCCtgcTCCTGATGCT | Eurofins (this paper) | Primer used for PCR in cloning experiment | |
| Sequence-based reagent | Primer: 53BP1 S366A mutagenesis Reverse (5’- > 3’): GATCTGAAGAATTCGTGGAAAGAC | Eurofins (this paper) | Primer used for PCR in cloning experiment | |
| Sequence-based reagent | Primer: 53BP1 T670A mutagenesis Forward (5’- > 3’): AATCCCTGAGgcaCCTTGTGAAAG | Eurofins (this paper) | Primer used for PCR in cloning experiment | |
| Sequence-based reagent | Primer: 53BP1 T670A mutagenesis Reverse (5’- > 3’): TCTTCCACCTCAGACCCTG | Eurofins (this paper) | Primer used for PCR in cloning experiment | |
| Peptide, recombinant protein | 53BP1 pT334 peptide 'Flu'-GYGGGCSLAS(pT)PATTLHL | Peptide Protein Research Limited (this paper) |
Fluorescein labelled for FP measurements | |
| Peptide, recombinant protein | 53BP1 pS366 peptide 'Flu'-GYGSSDLVAP(pS)PDAFRST | Peptide Protein Research Limited (this paper) | Fluorescein labelled for FP measurements | |
| Peptide, recombinant protein | 53BP1 pS380 peptide 'Flu'-GYGTPFIVPS(pS)PTEQEGR | Peptide Protein Research Limited (this paper) | Fluorescein labelled for FP measurements | |
| Peptide, recombinant protein | 53BP1 pT670 peptide 'Flu'-GYGEVEEIPE(pT) PCESQGE |
Peptide Protein Research Limited (this paper) |
Fluorescein labelled for FP measurements | |
| Peptide, recombinant protein | 53BP1 pS366 peptide SSDLVAP(pS)PDAFRST | Peptide Protein Research Limited (this paper) |
||
| Peptide, recombinant protein | 53BP1 pT670 peptide EVEEIPE(pT)PCESQGE | Peptide Protein Research Limited (this paper) | ||
| Commercial assay or kit | In-Fusion HD Cloning Kit | Clonetech | Cat#639646 | |
| Commercial assay or kit | APEX Alexa Fluor 555 Antibody Labeling Kit (used for pS366 and pT670 53BP1 antibodies) | Invitrogen by ThermoFisher Scientific | Cat#A10470 lot 1831224 | |
| Commercial assay or kit | Click-iT EdU Alexa Fluor 647 Imaging Kit | Invitrogen by ThermoFisher Scientific |
Cat#C10340 | |
| Commercial assay or kit | Q5 Site-Directed Mutagenesis Kit | New England Biolabs | Cat#E0554S | |
| Commercial assay or kit | Premo FUCCI Cell Cycle Sensor (BacMam 2.0) | ThermoFisher Scientific | Cat#P36238 | |
| Commercial assay or kit | Pierce ECL Western Blotting Substrate |
ThermoFisher Scientific |
Cat#32209 lot RE232713 | |
| Commercial assay or kit | Cell Line Nucleofector Kit V | Lonza | Cat#VCA-1003 | |
| Chemical compound, drug |
NanoJuice Transfection Kit | EMD Millipore Corp | Cat#71902 | |
| Chemical compound, drug | Fisher BioReagents Bovine Serum Albumin (BSA) Fatty Acid-free Powder | Fisher Scientific by ThermoFisher Scientific | Cat# BP9704-100 CAS: 9048-46-8 | |
| Chemical compound, drug | ProLong Diamond Antifade Mountant ThermoFisher Scientific | Invitrogen by ThermoFisher Scientific |
Cat# P36965 | |
| Chemical compound, drug | NuPAGE 3–8% Tris-Acetate Protein Gels |
Invitrogen by ThermoFisher Scientific |
Cat#EA0378BOX | |
| Chemical compound, drug | NuPAGE Antioxidant | Invitrogen by ThermoFisher Scientific |
Cat#NP0005 | |
| Chemical compound, drug | NuPAGE Sample Reducing Agent (10X) | Invitrogen by ThermoFisher Scientific | Cat#NP0004 | |
| Chemical compound, drug | NuPAGE LDS Sample Buffer (4X) | Invitrogen by ThermoFisher Scientific |
Cat#NP0007 | |
| Chemical compound, drug | Benzonase Nuclease | Santa Cruz Biotechnology | Cat#sc-202391 | |
| Chemical compound, drug | Phosphatase Inhibitor Cocktail C | Santa Cruz Biotechnology | Cat#sc-45065 | |
| Chemical compound, drug | G418 Disulfat Salt | Sigma-Aldrich | A1720 ; CAS: 108321-42-2 | |
| Chemical compound, drug | Nocodazole | Sigma-Aldrich | SML1665; CAS: 31430-18-9 | |
| Chemical compound, drug | 5-Bromo-2’-deoxyuridine (BrDU) | Sigma-Aldrich | B5002; CAS: 59-14-3 | |
| Chemical compound, drug | bisBenzimide H33352 trihydrochloride (Hoechst 33342) | Sigma-Aldrich | B2261 ; CAS: 23491-52-3 | |
| Chemical compound, drug | Monoclonal Anti-HA−Agarose antibody produced in mouse |
Sigma-Aldrich | A2095 | |
| Chemical compound, drug | cOmplete, EDTA-free Protease Inhibitor Cocktail | Sigma-Aldrich | 000000005056489001; COEDTAF-RO ROCHE | |
| Chemical compound, drug | Duolink In Situ Orange Starter Kit Goat/Rabbit | Sigma-Aldrich | DUO92106 | |
| Chemical compound, drug | Lipofectamine RNAiMAX Transfection Reagent | ThermoFisher Scientific | Cat# #13778015 | |
| Chemical compound, drug | Phusion Flash High Fidelity Master Mix | ThermoFisher Scientific | Cat#F-548 | |
| Chemical compound, drug | Pierce ECL Western Blotting Substrate | ThermoFisher Scientific | Cat#32209 lot RE232713 | |
| Software, algorithm | Prism six for Mac OS X (v6.0h) | GraphPad Software |
https://www.graphpad.com
RRID:SCR_002798 |
|
| Software, algorithm | Cell Profiler (2.2.0) | Broad Institute | http://cellprofiler.org/ RRID:SCR_007358 | |
| Software, algorithm | FIJI | ImageJ software | http://fiji.sc/ RRID:SCR_002285 | |
| Software, algorithm | Micro-Manager (µManager) | Vale Lab, UCSF | https://micro-manager.org/ RRID:SCR_000415 | |
| Software, algorithm | SlideBook6 | Intelligent Imaging Innovations (3i) | https://www.intelligent-imaging.com/slidebookRRID:SCR_014300 | |
| Software, algorithm | SnapGene | GSL Biotech LLC | http://www.snapgene.com/ RRID:SCR_015052 | |
| Software, algorithm | NEBaseChanger v1.2.6 | New England Biolabs | http://nebasechanger.neb.com/ | |
| Software, algorithm | CCP4 | Combined Crystallographic Computing Project | http://www.ccp4.ac.uk/ RRID:SCR_007255 | |
| Software, algorithm | Phenix | Phenix Consortium | https://www.phenix-online.org/ RRID:SCR_014224 | |
| Software, algorithm | Buster | Global Phasing | https://www.globalphasing.com/buster/ RRID:SCR_015653 | |
| Other | Microscope: Olympus-3i spinning disc | Olympus | N/A | |
| Other | Microscope: Olympus IX70 Core DeltaVision | Olympus | N/A | |
| Other | Bioruptor Pico sonication device | Diagenode | Cat# B01060001 | |
| Other | ImageQuant LAS 4000 | GE Healthcare Life Sciences | Cat#28955810 |