Skip to main content
. 2019 Jun 14;7:e7121. doi: 10.7717/peerj.7121

Table 1. Primers used in this study.

Locus-specific primers were synthesized with linker sequences to allow for two-stage PCR amplification and incorporation of sample-specific barcodes, as described in the text. Primer 806R is 18-fold degenerate, and variants were synthesized as a pool as well as individually. Access Array primer sequences, synthesized by Fluidigm (PE1-CS1 and PE2-[BC]-CS2), are shown in Fig. 2.

341F primer Primer sequence Linker (CS1) sequence Final sequence name Final sequence ordered
341F CCTACGGGAGGCAGCAG ACACTGACGACATGGTTCTACA >CS1_515F ACACTGACGACATGGTTCTACACCTACGGGAGGCAGCAG