FIG 5.
Gene expression increases in ΔCTRL2-infected mice ganglia. Real-time PCRs using the primers and probes listed in Table 2 were done to quantitate HSV-1 LAT, ICP0, ICP4, ICP27, and VP16 expression at 31 days postinfection. Mouse TG were isolated and placed in RNAlater and stored according to the manufacturer’s specifications. RNA was extracted by removing RNAlater from samples and adding TRIzol reagent (Sigma-Aldrich) to each sample. RNA was precipitated and DNase treated, and reverse transcription was done using a high-capacity One Step cDNA reverse transcription kit (ABI), according to the manufacturer’s instructions. In the case of ICP0, a 10-μl aliquot of purified RNA was used with the strand-specific primer for the ICP0 transcript (LAT I-1, GACACGGATTGGCTGGTGTAGTGGG; nucleotides 120797 to 120820) (37). Controls for qRT-PCRs included no-template and no-reverse transcriptase wells for each plate for each gene analyzed. One-way ANOVA was used to determine statistical relevance of the expression data (n = 6 to 8). **, P < 0.05.