| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Mouse monoclonal anti-SH-PTP1 (D-11) | Santa Cruz biotechnology | Cat# sc-7289; RRID: AB_628251 |
| Mouse monoclonal anti-SHP2 | Cell signaling technology | Cat# 3752; RRID: AB_2300607 |
| Rabbit polyclonal anti-VAV1 | Cell signaling technology | Cat# 2502; RRID: AB_2213556 |
| Mouse monoclonam anti-pSLP76 (Y128) | BD Pharmigen | Cat# 558367; RRID: AB_647331 |
| Rabbit polyclonal anti-pZAP70 (Y493) | Cell signaling technology | Cat# 2704; RRID: AB_2217457 |
| Rabbit monoclonal anti-ZAP70 | Cell signaling technology | Cat# 2705; RRID: AB_2273231 |
| Rabbit polyclonal anti-pLAT (Y171) | Cell signaling technology | Cat# 3581S; RRID: AB_2157730 |
| Rabbit polyclonal anti-SLP76 | Cell signaling technology | Cat# 4958; RRID: AB_2136713 |
| Goat polyclonal anti-CD28 | Santa Cruz biotechnology | Cat# sc-1623; RRID: AB_2073867 |
| Mouse anti-human CD28 (CD28.2) | Biolegend | Cat# 302902; RRID: AB_314304 |
| Mouse monoclonal anti-Phosphotyrosine (clone 4G10) | Millipore | Cat# 05-321; RRID: AB_309678 |
| Rabbit monoclonal anti-human PD-1 (D4W2J) | Cell signaling technology | Cat# 86163; RRID: AB_2728833) |
| Rat polyclonal anti-mouse PD-1 (RMP1-14) | Biolegend | Cat# 114102; RRID: AB_313573 |
| Goat polyclonal anti-mouse BTLA | R&D systems | Cat# AF3007; RRID: AB_2243788 |
| Goat anti-rabbit IgG CF770 | Biotium | Cat# 20078; RRID: AB_10563034 |
| Goat antimouse IgG CF680 | Biotium | Cat# 20065; RRID: AB_10557108 |
| Sheet anti-mouse HRP | GE Healthcare | Cat# NA9310-1ml; RRID: AB_772193 |
| Donkey anti-rabbit HRP | GE Healthcare | Cat# NA9340-1ml; RRID: AB_772191 |
| Purified anti-CD28 (37-51) | Exbio Praha | Cat# 12-597-C500; RRID: AB_10734810 |
| Purified anti-CD3 (145-2C11) | Exbio Praha | Cat# 12-578-C500; RRID: AB_10738256 |
| Rabbit monoclonal anti-p44/42 MAPK (197G2) PE | Cell signaling technology | Cat# 14095; RRID: AB_2728834 |
| anti-mouse CD19 (6D5) APC Fire750 | Biolegend | Cat# 115558; RRID: AB_2572120 |
| anti-mouse CD25 (PC61) FITC | Biolegend | Cat# 102006; RRID: AB_312855 |
| anti-mouse CD3e (145-2C11) PE | Biolegend | Cat# 100307; RRID: AB_312672 |
| anti-mouse CD4 (RMA4-5) BV650 | BD Biosciences | Cat# 563747; RRID: AB_2716859 |
| anti-mouse CD44 (IM7) PE-Cy7 | BD Biosciences | Cat# 560569; RRID: AB_1727484 |
| anti-mouse CD5 (53-7.3) Pe-Cy5 | BD Biosciences | Cat# 553024; RRID: AB_394562 |
| anti-mouse CD62L (MEL-14) FITC | BD Biosciences | Cat# 553150; RRID: AB_394665 |
| anti-mouse CD8a (53-6.7) AF700 | Biolegend | Cat# 100730; RRID: AB 493703 |
| anti-mouse CD272 (BTLA, 8F4) PE | Biolegend | Cat# 134804; RRID: AB_1731884 |
| anti-mouse CD279 (PD-1,RPM1-30) PE | Biolegend | Cat# 109104; RRID: AB_313421 |
| anti-mouse IgG1 κ isotype control (P3.6.2.8.1) PE | eBioscience | Cat# 12-4714-82; RRID: AB_470060 |
| Anti-rat IgG2b κ isotype control PE | BD Biosciences | Cat# 553989; RRID: AB_10049479 |
| anti-mouse TCRβ (H57-597) BV421 | BD Biosciences | Cat# 562839; RRID: AB_2737830 |
| anti-human CD69 (FN50) PE | Biolegend | Cat# 310906; RRID: AB_314841 |
| anti-human CD28 (CD28.2) PE | BD Biosciences | Cat# 555729; RRID: AB_396072 |
| anti-human CD3ε (OKT3) APC | Invitrogen | Cat# 17-0037-42; RRID: AB_1907372 |
| anti-human CD5 (UCHT2) PE-Cy7 | Biolegend | Cat# 300622; RRID: AB_2275812 |
| anti-human CD5 (UCHT2) APC | Biolegend | Cat# 300612; RRID: AB_314098 |
| anti-human CD19 (HIB19) FITC | BD Biosciences | Cat# 555412; RRID: AB_395812 |
| anti-human CD19 (HIB19) BV421 | BD Biosciences | Cat# 562441; RRID: AB_11154587 |
| anti-human CD86 (IT2.2) APC | Biolegend | Cat# 305411; RRID: AB_493232 |
| anti-human CD80 (2D10) BV421 | Biolegend | Cat# 305221; RRID: AB_10899567 |
| anti-human CD272 (BTLA, MIH26) PE-Cy7 | Biolegend | Cat# 344515; RRID: AB_2629565 |
| anti-human CD270 (HVEM, TR2) PE-Cy7 | Biolegend | Cat# 318809; RRID: AB_2565254 |
| anti-human CD279 (PD-1, EH12.2H7) BV421 | Biolegend | Cat# 329920; RRID: AB_10960742 |
| anti-human CD274 (PD-L1, MIH1) eFluor450 | eBioscience | Cat# 48-5983-42; RRID: AB_2574091 |
| anti-human CD273 (PD-L2, MIH18) PE | Biolegend | Cat# 345505; RRID: AB_1953231 |
| anti-human HLA-DR (LN3) PE | eBioscience | Cat# 12-9956-42; RRID: AB_10698015 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Sodium Orthovanadate | Acros organics | Cat# 205330500 |
| Hydrogen Peroxide Solution | Sigma Aldrich | Cat# 216763 |
| Phorbol 12-myristate 13-acetate (PMA) | EMD Millipore | Cat# 19-144 |
| Ionomycin calcium salt from Streptomyces conglobatus | Sigma Aldrich | Cat# I0634 |
| Strep-Tactin Sepharose beads | IBA Lifesciences | Cat# 2-1201-010 |
| D-biotin | Sigma Aldrich | Cat# B4501 |
| PNGaseF | New England Biolabs | Cat# P0704S |
| n-Dodecyl-β-D-maltoside | Merck | Cat# 324355 |
| Aprotinin | Roche | Cat# 10981532001 |
| Leupeptin | Roche | Cat# 11034626001 |
| PMSF | Roche | Cat# 2088311 |
| Nα-Tosyl-L-lysine chloromethyl ketone hydrochloride | Sigma-Aldrich | Cat# T7254 |
| N-p-Tosyl-L-phenylalanine chloromethyl ketone | Sigma-Aldrich | Cat# T4376 |
| Enterotoxin type E Recombinant Protein - 1 mg (E-Coli) | Mybiosource | Cat# mbs1112600 |
| iRT peptides | Biognosys | N/A |
| Trypsin | Promega | Cat#V5113 |
| Critical Commercial Assays | ||
| DB UNTOUCHED MOUSE CD4 CELLS KIT | Life technologies | Cat# 11415D |
| CellTiter-Glo® Luminescent Cell Viability Assay | Promega | Cat# G7571 |
| Cell line nucleofector kit V | Lonza | Cat# VCA-1003 |
| Human IL-2 DuoSet ELISA | R&D Systems | Cat# DY202 |
| Experimental Models: Cell Lines | ||
| Jurkat, Clone E6-1 | ATCC | Cat# TIB-152; RRID: CVCL_0367 |
| Jurkat-PD-1 | This paper | N/A |
| Jurkat-PD-1OST | This paper | N/A |
| Jurkat-PD-1OST SHP-1– | This paper | N/A |
| Jurkat-PD-1OST SHP-2– | This paper | N/A |
| Jurkat-PD-1OST SHP-1– SHP-2– | This paper | N/A |
| Raji | ATCC | Cat# CCL-86; RRID:CVCL_0511 |
| Raji-PD-L1 | This paper | N/A |
| Raji-PD-L1 SHP-2– | This paper | N/A |
| Experimental Models: Organisms/Strains | ||
| PD-1OST mice | This paper | B6-Pdcd1tm1Ciphe |
| BTLAOST mice | This paper | B6-Btlatm1Ciphe |
| Oligonucleotides | ||
| PDL1 Fw CGGAATTCCGGCCACCATGAGGATAT TTGCTGTC |
This paper | N/A |
| PDL1 Rev GCTTTGTTTAAACGGCGAATGCGGCC GCTA TTACGTCTCCTCCAAATGTGTATCACTTTGC |
This paper | N/A |
| Recombinant DNA | ||
| pEF6/Myc-His | Thermofisher Invitrogen | Cat# V96220 |
| Software and Algorithms | ||
| R V3.3 | GNU General public license | https://www.r-project.org/ |
| R studio V1.0.136 | GNU General public license | https://www.rstudio.com/ |
| FlowJo V10 | TreeStar, FlowJo LLC, Ashland, Oregon | https://www.flowjo.com/ |
| GraphPad Prism 7 | GraphPad Software, Inc., California | https://www.graphpad.com/scientific-software/prism/ |
| FACSDiva software v8 | BD FACSDivaTM | http://www.bdbiosciences.com/us/instruments/research/software/ |
| Spectronaut X | Biognosys, Schlieren, Switzerland | https://biognosys.com |
| MaxQuant v.1.5.2.8 | Max Plank Institute of Biochemistry, Germany | https://www.maxquant.org/ |
| mapDIA | PMID: 26381204 | https://sourceforge.net/projects/mapdia/ |
| PECA package | PMID: 28724900 | http://bioconductor.org/packages/PECA/ |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.