Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Upper and lower primers of aqp9, aqp7, and GADPH in SD rats.
| gene | sequences of the primers | amplified fragments |
|---|---|---|
| aqp7 | Sense primer: tcgtgactgggatgctgc | 158bp |
| Reverseprimer: acgggatgggttgattgc | ||
| aqp9 | Sense primer: aaggacggtgccaagaa | 197bp |
| Reverseprimer: atcacgactgccgatgc | ||
| GAPDH | Sense primer: ccatccacagtcttctgagt | 141bp |
| Reverse primer: cctcaagattgtcagcaat |
