| gene | Primer F | Primer R |
|---|---|---|
| DCN | agaagctctcctacatccgc | ccaagtgaagctccctcaga |
| SRGN | attttcccaccttgacacca | ttttatggccatgggaatat |
| ZEB1 | catacacctactcaactac | tttcatcctgatttccatt |
| Col8A1 | catttaccgccgagctaacc | tgtctgcgggttgtagttct |
| Snail | gaaaggccttcaactgcaaa | tgacatctgagtgggtctgg |
| Twist | cgggagtccgcagtctta | gcttgagggtctgaatcttg |
| Rab25-2 | cctaaccaagcaccagacct | gctgttctgtctctgcttgg |
| CDH1-2 | tgaagaaggaggcggagaag | ctcagactagcagcttcgga |
| ESRP1-2 | tttgaatccacgagcactgc | taagtccatcctcggttgca |
| MMP2-2 | aggaggagaaggctgtgttc | ctccagttaaaggcggcatc |
| TP63-2 | atgcccagactcaatttagtga | ttctgcgcgtggtctgtgt |
| OVOL2 | tgcaacgtctgcaataaagc | acgtgcaggtacaggtcctc |
| EPCAM | tgcagggtctaaaagctggt | ccctatgcatctcacccatc |
| ITGB6 | tgcgaccatcagtgaagaag | gacaaccccgatgagaagaa |
| CLDN4 | ccggccttatggtgatagtg | gcggagtaaggcttgtctgt |
| IRF6 | gtgaatgccatcttcttccttct | cccaggccaaatctccttct |
| ICAM1-2 | atacaacagcatttggggcc | ccacttcccctctcatcagg |
| Wnt5a | cccgatttagcagtgtcagc | tacacagtgccagtctcagg |
| RAET1L | cttctgttcctgctgttcgg | cgggtgtgactgtcttgttg |
| S100A4 | gagcaacttggacagcaaca | tcatttcttcctgggctgct |
| CD112-2 | ccatgtatgtgtgagctgcc | tttctctgggctcatgggtt |
| CD155-2 | tggggtgaaaatgtctgtgc | ggtttactccagcctccact |
| GAPDH | tgcaccaccaactgcttagc | ggcatggactgtggtcatgag |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.