TABLE 2.
Strains and plasmids used in this study
| Strain or plasmid | Descriptiona | Source or reference |
|---|---|---|
| Strains | ||
| E. coli TOP10 | F– mcrA Δ(mrr-hsdRMS-mcrBC) φ80lacZΔM15 ΔlacX74 recA1 araD139 Δ(ara leu) 7697 galU galK rpsL (Smr) endA1 nupG | Invitrogen |
| E. coli S17-1 λpir | Donor strain; Tpr Smr recA thi pro hsd(r–m+) RP4-2-Tc::Mu::Km Tn7 λpir | 41 |
| mbaR E. coli reporter strain PmbaI-gfp | Acyl-HSL reporter strain; E. coli TOP10 with pAWP112 and pAWP113 | 12 |
| mmsR E. coli reporter strain P12745-gfp | Acyl-HSL reporter strain; E. coli TOP10 with pAWP134 and pAWP169 | This study |
| mmsR E. coli reporter strain with mutated lux box, P12745mut-gfp | Acyl-HSL reporter strain; E. coli TOP10 with pAWP134 and pAWP179 | This study |
| M. tundripaludum strain 21/22 | Aerobic methane-oxidizing bacterium isolated from sediment from Lake Washington (Seattle, WA, USA) | 13 |
| M. tundripaludum strain 21/22 ΔmbaI strain | Strain containing unmarked deletion of luxI-type acyl-HSL synthase gene mbaI (T451DRAFT_0796) | 12 |
| Methylomonas sp. strain LW13 | Aerobic methane-oxidizing bacterium isolated from sediment from Lake Washington | 13 |
| Methylomonas sp. strain LW13 ΔmmsR strain | Strain containing unmarked deletion of orphan luxR-type transcription factor gene mmsR (U737_12750) | This study |
| Methylomonas sp. strain LW13 ΔmmsR::mmsR strain | ΔmmsR with mmsR under its native promoter (400-bp upstream sequence) inserted between U737_06900 and U737_06905 | This study |
| Plasmids | ||
| pAWP112 | pPROBE-gfp[LVA] (39) containing gfp driven by the PmbaI promoter | 12 |
| pAWP113 | pACYC184 (49) expressing mbaR under its native promoter (400-bp upstream sequence) | 12 |
| pAWP134 | pACYC184 (49) expressing mmsR under its native promoter (400-bp upstream sequence) | This study |
| pAWP136 | pCM433kanT (42) containing flanks to create clean deletion of mmsR | This study |
| pAWP169 | pPROBE-gfp[LVA] (39) containing gfp driven by −400 bp to +21 bp of the translational start site of U737_12745 | This study |
| pAWP179 | pAWP169 with mutation of CT to TA in MmsR binding site (AGCTGTCAATATTGACAGTT to AGTAGTCAATATTGACAGTT) (see Fig. 2) | This study |
| pAWP195 | Insertion vector (site between U737_06900 and U737_06905) | This study |
| pAWP197 | pAWP195 containing mmsR under its native promoter (400-bp upstream sequence) for insertion between U737_06900 and U737_06905 | This study |
a
Smr, streptomycin resistance; Tpr, trimethoprim resistance.