Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (M. musculus) | ReckΔex2 | PMID: 20691046 | RRID:MGI:4830344 | |
| Genetic reagent (M. musculus) | ReckP256A,W261A | this paper | Please find details under Materials and methods (Gene Targeting) |
|
| Cell line (H. sapiens) | HEK/293T | ATCC | Cat. #: CRL-3216; RRID:CVCL_0063 | |
| Cell line (H. sapiens) | Super TOP Flash (STF) luciferase reporter cell line | PMID: 15035989 | ||
| Antibody | Rabbit polyclonal anti-Glut1 | Thermo Fisher Scientific | Cat. #: RB-9052-P1; RRID: AB_177895 | 1:400 dilution |
| Antibody | Rat monoclonal anti-PECAM/CD31 | BD Biosciences | Cat. #: 553370; RRID: AB_394816 | 1:400 dilution |
| Antibody | Isolectin GS-IB4 (GS Lectin), Alexa 488 conjugate | Thermo Fisher Scientific | Cat. #: I21411, RRID: AB_2314662 |
1:400 dilution |
| Antibody | Rabbit polyclonal anti-6xMyc | PMID: 28803732 | 1:10,000 dilution | |
| Antibody | Rat monoclonal anti-alpha tubulin |
Thermo Fisher Scientific | Cat# MA1-80017; RRID: AB_2210201 |
1:10,000 dilution |
| Antibody | Mouse monoclonal anti-actin | Millipore Sigma | Cat. #: MAB1501; RRID: AB_2223041 | 1:10,000 dilution |
| Antibody | Rabbit monoclonal anti-Reck | Cell Signaling | Cat. #: 3433S; RRID: AB_2238311 | 1:2000 dilution |
| Antibody | Alkaline phosphatase horse anti-mouse IgG antibody | Vector Laboratories | Cat. #: AP-2000; RRID:AB_2336173 | 1:10,000 dilution |
| Antibody | Goat polyclonal anti-rabbit IgG (H + L) cross-adsorbed secondary antibody, Alexa 488, 594, and 647 conjugates | Thermo Fisher Scientific | Cat. #s: A-11008, RRID: AB_143165; A-11012, RRID: AB_2534079; A-21244, RRID: AB_2535812 | 1:400 dilution |
| Antibody | Goat polyclonal anti-rat IgG (H + L) cross-adsorbed secondary antibody, Alexa 488, 594, and 647 conjugates | Thermo Fisher Scientific | Cat. #s: A-11006, RRID: AB_2534074; A-11007, RRID: AB_2534075; A-21247, RRID: AB_141778 | 1:400 dilution |
| Antibody | IRDye 800CW goat anti-mouse IgG (H + L) secondary antibody | LI-COR | Cat. #: 925–32210; RRID:AB_2687825 | 1:10,000 dilution |
| Antibody | IRDye 680RD goat anti-rabbit IgG (H + L) secondary antibody | LI-COR | Cat. #: 925–68071; RRID:AB_2721181 | 1:10,000 dilution |
| Antibody | IRDye 680RD goat anti-rat IgG (H + L) secondary antibody | LI-COR | Cat. #: 926–68076; RRID:AB_10956590 | 1:10,000 dilution |
| Oligonucleotides | ReckP256A,W261A guide RNA: caagatcctctttggcagtg | this paper | Please find details under Materials and methods (Gene Targeting) | |
| Oligonucleotides | ReckP256A,W261A SSODN HDR template: gttgatggtctcattgagggttgtaagacccagcccttggcacaagatcctcttgcccagtgttttctcgaaagctcacagtcggttcaccctgga | this paper | Please find details under Materials and methods (Gene Targeting) | |
| Recombinant DNA reagents | Mouse Frizzled CRD-GPI cDNA | PMID: 17158104 | ||
| Recombinant DNA reagents | Mouse Norrin, Wnts, and Frizzleds cDNA | PMID: 23095888 | ||
| Recombinant DNA reagents | Mouse Tspan12 cDNA | PMID: 30478038 | ||
| Recombinant DNA reagents | Mouse Reck cDNA | PMID: 28803732 | ||
| Recombinant DNA reagents | Mouse Gpr124 cDNA | PMID: 28803732 | ||
| Recombinant DNA reagents | Frizzled chimera cDNA | this paper | Please find details under Materials and methods (Plasmids) | |
| Recombinant DNA reagents | Wnt7a chimera and mutant cDNA | this paper | Please find details under Materials and methods (Plasmids) | |
| Recombinant DNA reagents | Reck mutant cDNA | this paper | Please find details under Materials and methods (Plasmids) | |
| Recombinant DNA reagents | Reck AP fusion cDNA | this paper | Please find details under Materials and methods (Plasmids) | |
| Commercial assay or kit | Dual-Luciferase Reporter Assay System | Promega | Cat. #: E1910 | |
| Chemical compound, drug | BluePhos phosphatase substrate solution (5-bromo-4-chloro-3-indolyl phosphate/tetrazolium) | Kirkegaard and Perry Laboratories | Cat. #: 50-88-00 | |
| Chemical compound, drug | EZ-Link Sulfo-NHS-LC-Biotin | Thermo Fisher Scientific | Cat. #: 21335 | |
| Chemical compound, drug | Nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrate | Roche | Cat. #: 11383213001 | |
| Software, algorithm | ImageJ | https://imagej.nih.gov/ij | ||
| Software, algorithm | Adobe Photoshop CS6 | https://adobe.com/photoshop | ||
| Software, algorithm | Adobe Illustrator CS6 | https://adobe.com/illustrator | ||
| Software, algorithm | GraphPad Prism 7 | http://www.graphpad.com | ||
| Other | FuGENE HD Transfection Reagent |
Promega | Cat. #: E2311 | |
| Other | Pierce NeutrAvidin agarose resin | Thermo Fisher Scientific | Cat. #: 29200 | |
| Other | Fluoromount G | EM Sciences | Cat. #: 17984–25 | |
| Other | Protease Inhibitor | Roche | Cat. #: 11836170001 |