Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Human) | K562 | ATCC | #CCL-243 | RRID: CVCL_0004 |
| Biological sample (Escherichia coli) | JM101 cells | Agilent | #200234 | |
| Antibody | rabbit polyclonal anti-NPAT | Thermo | PA5-66839 | Concentration: 1:100; RRID:AB_2663287 |
| Antibody | guinea pig polyclonal anti-rabbit IgG | Antibodies Online | ABIN101961 | Concentration: 1:100; RRID: AB_10775589 |
| Antibody | rabbit polyclonal anti-mouse IgG | Abcam | 46540 | Concentration: 1:100; RRID: AB_2614925 |
| Antibody | rabbit monoclonal anti-RNAPII-Ser5 | Cell Signaling | D9N51 | Concentration: 1:100 |
| Antibody | mouse monoclonal anti-RNAPII-Ser5 | Abcam | 5408 | Concentration: 1:100; RRID:AB_304868 |
| Antibody | rabbit monoclonal anti-H3K27me3 | Cell Signaling | 9733 | Concentration: 1:100; RRID: AB_2616029 |
| Antibody | rabbit polyclonal anti-H3K4me2 | Upstate | 07–730 | Concentration: 1:100; RRID: AB_11213050 |
| Antibody | rabbit monoclonal anti-H3K27ac | Millipore | MABE647 | Concentration: 1:100; |
| Antibody | rabbit polyclonal anti-H3K27ac | Abcam | 4729 | Concentration: 1:100; RRID: AB_2118291 |
| Antibody | rabbit polyclonal anti-CTCF | Millipore | 07–729 | Concentration: 1:100; RRID: AB_441965 |
| Recombinant DNA reagent | AG-ERH-MNase-6xHIS-HA (plasmid) | Progenitors: pK19-pA-MN; gBlocks | ||
| Recombinant DNA reagent | pK19-pA-MN | Schmid et al., 2004 | Gift from author | |
| Sequence-based reagent | gBlock Hemagglutinin and 6-histidine tags; gattacaGAAGACAACGCTGATTCAGGTCAAGGCGGtGGTGGcTCTGGgGGcGGgGGcTCGGGtGGtGGgGGcTCAcaccatcaccatcaccatGGCGGtGGTGGcTCTTACCCATACGATGTTCCAGATTACGCTtaatgaGGATCCgattaca | Integrated DNA Technologies (IDT) | ||
| Sequence-based reagent | gBLOCK PrtG_ERH Codon optimized; AGCAGAAGCTAAAAAGCTAAACGATGCTCAAGCACCAAAAACAACTTATAAATTAGTCATCAACGGGAAAACGCTGAAGGGTGAAACCACGACAGAGGCCGTAGATGCGGAGACAGCGGAGCGCCACTTTAAGCAATACGCGAATGATAACGGTGTAGACGGCGAGTGGACCTACGACGACGCGACAAAGACCTTTACCGTCACGGAGAAACCTGAGGTTATCGACGCGTCTGAGTTGACGC CAGCCGTAGATGACGATAAAGAATTCGCAACTTCAACTAAAAAATTAC |
Integrated DNA Technologies (IDT) | ||
| Peptide, recombinant protein | pA/MNase | Schmid et al., 2004 | purified as described inSchmid et al., 2004 and supplementary | |
| Peptide, recombinant protein | pAG/MNase | This paper | Purified from modified plasmid pAG-ERH-MNase-6xHIS-HA in S Henikoff Lab |
|
| Commercial assay or kit | Pull-Down PolyHis Protein:Protein Interaction Kit | Thermo | #21277 | |
| Other | Concanavalin A coated magnetic beads | Bangs Laboratories | #BP-531 | |
| Other | Gibson Assembly | New England Biolabs | #E2611 | |
| Other | Chicken egg white lysozyme | EMD Millipore | #71412 | |
| Other | Zwittergent 3–10 detergent (0.03%) | EMD Millipore | #693021 | |
| Chemical compound, drug | Digitonin | EMD Millipore | #300410 | |
| Chemical compound, drug | Roche Complete Protease Inhibitor EDTA-free tablets | Sigma Aldrich | 5056489001 | |
| Chemical compound, drug | RNase A Dnase- and protease-free | Thermo | ENO531 | 10 mg/ml |
| Chemical compound, drug | Proteinase K | Thermo | EO0492 | |
| Chemical compound, drug | Glycogen | Sigma-Aldrich | 10930193001 | |
| Chemical compound, drug | Spermidine | Sigma-Aldrich | #S0266 |