Key Resources Table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Critical Commercial Assays
mMessage mMachine Sp6 Transcription Kit	Thermo Fisher Scientific	Cat#AM1340
Deposited Data
Wnt8a morpholino and control RNA-seq	Nakamura et al., 2016	GEO: GSE72657
Foxh1 morpholino and control RNA-seq	Chiu et al., 2014	GEO: GSE53654
E2a morpholino and control RNA-seq	Wills et al., 2015	GEO: GSE56169
Lim/Otx2 morpholino, Gsc morpholinos and control RNA-seq	Yasuoka et al., 2014	DRA: DRA000516, DRA000517, DRA000518, DRA001093, DRA001094, DRA001095
Mov10 morpholino and control RNA-seq	Skariah et al., 2018	GEO: GSE86382
Beta-catenin morpholino and control RNA-seq	Ding et al., 2017	GEO: GSE93195
Tbp/Tlf/Tbp2 morpholino, Gcn5 antisense DNA and control RNA-seq	Gazdag et al., 2015	GEO: GSE76995
Ascl1 morpholino and control RNA-seq	Gao et al., 2016	GEO: GSE76915
Rfx2 morpholino and control RNA-seq	Kwon et al., 2014	GEO: GSE50593
Tcf21 morpholino and control RNA-seq	Tandon et al., 2013	GEO: GSE45786
Cdx1, Cdx2, Cdx4 and Cdx1/2/4 morpholinos, and control RNA-seq	Marlétaz et al., 2015	GEO: GSE71006
Tbxt/Tbxt2 morpholino and control RNA-seq	Gentsch et al., 2013	GEO: GSE48663
Foxn4 morpholino and control RNA-seq	Campbell et al., 2016	GEO: GSE89271
Ptbp1 morpholino, Exosc9 morpholino and control RNA-seq	Noiret et al., 2016	GEO: PRJEB8711
Tra2b morpholino and control RNA-seq	Dichmann et al., 2015	GEO: PRJNA266550
Tbxt/Tbxt2 morpholino and control RNA-seq	Gentsch et al., 2018	GEO: GSE96655
X. tropicalis genome version 9.0	Hellsten et al., 2010; Karimi et al., 2018	RRID:SCR_003280; URL:http://www.xenbase.org/
X. laevis genome v9.2	Session et al., 2016; Karimi et al., 2018	RRID:SCR_003280; URL:http://www.xenbase.org/
Experimental Models: Organisms/Strains
X. tropicalis, out-bred Nigerian	University of Virginia, NASCO	URL:https://www.enasco.com/
Oligonucleotides
X. tropicalis smn2 RT primer forward: AAATTCCCAGGACCAAAAGG	Integrated DNA Technologies	N/A
X. tropicalis smn2 RT primer reverse: ACACGTGTCGCCTACTCTCC	Integrated DNA Technologies	N/A
X. tropicalis tp53 RT primer forward: CCCTCAACTGAGGATTACGC	Integrated DNA Technologies	N/A
X. tropicalis tp53 RT primer reverse: CTTGTTGAGGTCGGTGGAGT	Integrated DNA Technologies	N/A
X. tropicalis tp53inp1 RT primer forward: CCCAGCCCTGATAGAACAGA	Integrated DNA Technologies	N/A
X. tropicalis tp53inp1 RT primer reverse: TTTCATTCGAGCAGCAAGAG	Integrated DNA Technologies	N/A
X. tropicalis c3ar1 RT primer forward: CAATATCAGGAATGGGACGAA	Integrated DNA Technologies	N/A
X. tropicalis c3ar1 RT primer reverse: TTCACTTCCGGTAACGTGCT	Integrated DNA Technologies	N/A
Standard control morpholino: 5’-CCTCTTACCTCAGTTACAATTTATA-3’	GeneTools	N/A
Software and Algorithms
RSEM v.1.2.12	Li and Dewey, 2011	RRID:SCR_013027; URL:http://deweylab.biostat.wisc.edu/rsem/
Bowtie 2 v2.2.7	Langmead and Salzberg, 2012	RRID:SCR_016368; URL:http://bowtie-bio.sourceforge.net/bowtie2/index.shtml
DEseq2	Love et al., 2014	RRID:SCR_016533;URL:https://github.com/PF2-pasteur-fr/SARTools
R v3.1.0	R Core Team, 2014	RRID:SCR_001905; URL:http://www.r-project.org/
Metascape	Tripathi et al., 2015	RRID:SCR_016620;URL:http://metascape.org/gp/index.html#/main/step1
Gene Ontology	Ashburner et al., 2000; The Gene Ontology Consortium, 2017	RRID:SCR_002143;URL:http://www.geneontology.org/