Table 1.
List of plasmids used in this work
| Plasmid name | Marker | Description | References |
|---|---|---|---|
| pRCC-K | kanMX | Rox3p-cas9-CYC1t; SNR52p-gRNA-SUP4t | [12] |
| pRCC-N | natMX | As pRCC-K, but with natMX resistance marker | [12] |
| pRCC-K_Bdh1/2 | kanMX | pRCC-K with target sequence (GAAAATCTATGTACCCACGC) for bdh1/2 deletion | This work |
| pRCC-N_Leu4/9 | natMX | pRCC-N with target sequence (TGTCACAATGACCGTGGTTG) for leu4/9 deletion | This work |
| pRCC-K_Ecm31 | kanMX | pRCC-K with target sequence (GAAGAACTGTGCTCCCG) for ecm31 deletion | This work |
| pRCC-K_Ilv1 | kanMX | pRCC-K with target sequence (TACTTTACCCGACGTCCC) for ilv1 deletion | This work |
| pRCC-K_Bat1 | kanMX | pRCC-K with target sequence (ACAAGAGCTTGGCCAGG) for bat1 deletion | This work |
| pRCC-K_Bat2 | kanMX | pRCC-K with target sequence (ACAAGAGCTTGGCCAGG) for bat2 deletion | This work |
| pRCC-K_Pdc1 | kanMX | pRCC-K with target sequence (TGTTCCAGACACGACGTCA) for pdc1 deletion | This work |
| pRCC-K_Pdc5 | kanMX | pRCC-K with target sequence (ACGAAGTAACCTCACAATC) for pdc5 deletion | This work |
| pRCC-K_Mth1 | kanMX | pRCC-K with target sequence (GCAGTATGCATTCAGCGAGC) for Mth1 modification | This work |
| pRCC-K_Adh1 | kanMX | pRCC-K with target sequence (TAACTTGATGGCCGGTCACT) for adh1 deletion | This work |
| pRCC-K_Gpd1 | kanMX | pRCC-K with target sequence (GTTTCGTCGAAGGTCTAGGC) for gpd1 deletion | Boles lab stock |
| pRCC-N_Gpd2 | natMX | pRCC-K with target sequence (CCCTTACATGAGGGGCCACG) for gpd2 deletion | This work |
| pRCC-K_Ald6 | kanMX | pRCC-K with target sequence (AAAACTTTGGCCTTAGCCCG) for ald6 deletion | This work |
| IsoV100 (p425-synthILV235) | kanMX |
2μ-plasmid with integrative ILV cassette which contains truncated ORFs of codon-optimized ILV2∆N54, codon-optimized ILV5∆N48 and codon-optimized ILV3∆N19 of S. cerevisiae; codon-optimized ILV2∆N54 under control of shortened HXT7 promoter and CYC1 terminator, codon-optimized ILV5∆N48 under control of FBA1 promoter and PGK1 terminator, codon-optimized ILV3∆N19 under control of PFK1 promoter and FBA1 terminator, loxP-kanMX-loxP resistance gene, flanked at 369 bp and 385 bp homologous to FMO1 locus, respectively, LEU2 marker gene; capability of integration into chromosomeVIII of codon-optimized ILV-cassette through in vivo recombination after restriction by AscI/PacI In this work, p425-synthILV235 (IsoV100) was only used as an episomal 2µ-plasmid with kanMX (G418) as the selectable marker |
[3] |
| pRS62N | natMX | 2µ, natNT2, AmpR, shortened HXT7 promotor (p− 1− 392HXT7) and CYC1 terminator | [9] |
| pRS62N-IlvC6E6 | natMX | pRS62N with IlvC6E6 from E. coli | This work |