Table 1.

The primers (5’ → 3’) and PCR condition for the CD28 and CTLA-4 and GAPDH transcripts

Gene	PCR Product length	Program
CD28 Forward primer: GCGTCTTTCAGTTCCCCTCA Reverse primer: GCTTCACCAAAATCTTGTTTCCTGT	150-bp	95°C/2 min, 40 cycles of 95 °C/30 sec, 60 °C/20 sec, and 70 °C/30 sec
CTLA-4 Forward primer: TACCCACCGCCATACTACCT Reverse primer: GGCACGGTTCTGGATCAATTA	70-bp	95 °C/2 min, 40 cycles of 95 °C/30 sec, 60 °C/20 sec, and 70°C/30 sec
GAPDH Forward primer: GGACTCATGACCACAGTCCA Reverse primer: CCAGTAGAGGCAGGGATGAT	119-bp	95 °C/2 min, 40 cycles of 95 °C/30 sec, 57.5 °C/20 sec, and 70 °C/30 sec