Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
List of primers used for allele specific quantification of HAB and LAB alleles in F1 offspring of rats and mice
| Species, gene, specificity | Orientation | Primer sequence (5′ → 3′) |
|---|---|---|
| Rat, Npsr1, common | (+) | ACTGTGGCCAGACGACTCCT |
| Rat, Npsr1, rHAB-specific | (−) | CCTCGGTTGTAGCTGCAGCATATC |
| Rat, Npsr1, rLAB-specific | (−) | CCTCGGTTGTAGCTGCAGCATACT |
| Mouse, Npsr1, common | (+) | GTGCTGTTCTCCACGTGCAG |
| Mouse, Npsr1, mLAB-specific | (−) | TCAGGGGCCATGAAGTCTCGT |
| Mouse, Npsr1, mHAB-specific | (−) | TCAGGGGCCATGAAGTCTCGC |
