TABLE 5.
Specific oligonucleotide probes for fluorescence in situ hybridization applied in this studya
| Probe | Target organism or specificity | Sequence (5′→3′) | FA concn (%) | Reference |
|---|---|---|---|---|
| SAR11-152R | SAR11 clade | ATTAGCACAAGTTTCCYCGTGT | 25 | 52 |
| SAR11-441R(ori) | SAR11 clade | TACAGTCATTTTCTTCCCCGAC | 25 | 52 |
| SAR11-441Rmod | SAR11 clade | TACCGTCATTTTCTTCCCCGAC | 25 | 52 (modified) |
| SAR11-487mod | SAR11 clade | CGGACCTTCTTATTCGGG | 25 | 53 (modified) |
| SAR11-487-h3 | Helper to SAR11-487mod | CGGCTGCTGGCACGAAGTTAGC | 25 | 72 |
| SAR11-542R | SAR11 clade | TCCGAACTACGCTAGGTC | 25 | 52 |
| SAR11-732R | SAR11 clade | GTCAGTAATGATCCAGAAAGYTG | 25 | 52 |
| PRO405 | Prochlorococcus | AGAGGCCTTCGTCCCTCA | 15 | 73 |
| AEGEAN169-395 | AEGEAN-169 clade | GTCACTCACGCTGCATTG | 20 | This study |
| AEGEAN169-395-comp | Competitor to AEGEAN169-395 | GTCACTCACGCGGCATTG | 20 | This study |
| AEGEAN169-395-h1 | Helper to AEGEAN169-395 | CTGGATCAGGGTTTCCCC | 20 | This study |
| AEGEAN169-395-h2 | Helper to AEGEAN169-395 | TACTTCCCTAAGGCCTTC | 20 | This study |
| AEGEAN169-744 | AEGEAN-169 clade | ATCTCAGCGTCAAAAATGG | 20 | This study |
| AEGEAN169-744-h1 | Helper to AEGEAN169-744 | CCTAGTTAGTCGCCTTCG | 20 | This study |
| AEGEAN169-744-h2 | Helper to AEGEAN169-744 | TGCTACCCACGCTTTCGT | 20 | This study |
| SAR86-1245 | SAR86 clade | TTAGCGTCCGTCTGTAT | 35 | 74 |
| SAR86-1245-h3 | Helper to SAR86 | GGATTRGCACCACCTCGCGGC | 35 | 74 |
| SAR86-1245-h5 | Helper to SAR86 | CCATTGTAGCACGTGTGTAGC | 35 | 74 |
| SAR202-312R | SAR202 clade | TGTCTCAGTCCCCCTCTG | 40 | 20 |
| SAR324-1412 | SAR324 clade | GCCCCTGTCAACTCCCAT | 35 | 23 |
| SAR406-97 | SAR406 clade | CACCCGTTCGCCAGTTTA | 40 | 75 |
a
For the detection of members of the SAR11 clade, the following probes were mixed according to methods described previously (72): SAR11-152R, SAR11-441R(ori), SAR11-441Rmod, SAR11-487mod, SAR11-542R, SAR11-732R, and helper SAR11-487-h3. For the detection of members of the AEGEAN-169 clade, the following probes were mixed: AEGEAN169-395 and AEGEAN169-744; their helpers AEGEAN169-395-h1, AEGEAN169-395-h2, AEGEAN169-744-h1, and AEGEAN169-744-h2; and the competitor AEGEAN169-395-comp. For the SAR86 clade, the probe SAR86-1245 was mixed with the helpers SAR86-1245-h3 and SAR86-1245-h5. All probes were mixed in equimolar concentrations. FA, formamide.