Key resources table.
| Reagent type or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Strain (P. aeruginosa) | PA14 | Rahme et al., 1995; PMID 7604262 | ||
| Strain (P. aeruginosa) | PA14 ∆pelA | Lee et al., 2007; PMID: 17824927 | ||
| Strain (P. aeruginosa) | PA14 ∆orn | Orr et al., 2015; PMID: 26305945 | ||
| Strain (P. aeruginosa) | PA14 ∆orn ∆pelA-G | Orr et al., 2015; PMID: 26305945 | ||
| Strain (P. aeruginosa) | PAK | Bradley, 1974; PMID: 4206974 | ||
| Strain (P. aeruginosa) | PAK ∆orn | This study | Generated using pEX-Gn-∆orn (PAK) | |
| Strain (E. coli) | XL10-Gold | Agilent | ||
| Strain (E. coli) | Stellar cells | Takara/Clontech | ||
| Strain (E. coli) | BL21(DE3) | New England Biolabs | ||
| Strain (E. coli) | NEB T7Iq | New England Biolabs | ||
| Genetic reagent (plasmid) | pET28-His6-SUMO-OrnVc | This study | cloned from custom DNA fragment (see below) for purification of His6-SUMO-OrnVc, OrnVc | |
| Genetic reagent (plasmid) | pET28-His6-SUMO-Rexo2 | This study | cloned from custom DNA fragment (see below) for purification of His6-SUMO-Rexo2, Rexo2 | |
| Genetic reagent (plasmid) | pDONR221-VC0341 (ornVc) | Rolfs et al., 2008; PMID: 18337508 | ||
| Genetic reagent (plasmid) | pDONR221-ornVc D12A | This study | site-directed mutagenesis to introduce alanine at D12 position | |
| Genetic reagent (plasmid) | pDONR221-ornVc L18A | This study | site-directed mutagenesis to introduce alanine at L18 position | |
| Genetic reagent (plasmid) | pDONR221-ornVc D59A | This study | site-directed mutagenesis to introduce alanine at D59 position | |
| Genetic reagent (plasmid) | pDONR221-ornVc Q111A | This study | site-directed mutagenesis to introduce alanine at Q111 position | |
| Genetic reagent (plasmid) | pDONR221-ornVc R130A | This study | site-directed mutagenesis to introduce alanine at R130 position | |
| Genetic reagent (plasmid) | pDONR221-ornVc Y129A | This study | site-directed mutagenesis to introduce alanine at Y129 position | |
| Genetic reagent (plasmid) | pDONR221-ornVc Y129W | This study | site-directed mutagenesis to introduce tryptophan at Y129 position | |
| Genetic reagent (plasmid) | pDONR221-ornVc W61A | This study | site-directed mutagenesis to introduce alanine at W61 position | |
| Genetic reagent (plasmid) | pDONR221-ornVc W61Y | This study | site-directed mutagenesis to introduce tyrosine at W61 position | |
| Genetic reagent (plasmid) | pDONR221-ornVc H66A | This study | site-directed mutagenesis to introduce alanine at H66 position | |
| Genetic reagent (plasmid) | pDONR221-ornVc H158A | This study | site-directed mutagenesis to introduce alanine at H158 position | |
| Genetic reagent (plasmid) | pVL847-ornVc | Orr et al., 2015; PMID: 26305945 | OrnVc from pDONR cloned into pVL847 for purification of His-MBP-OrnVc, OnrVc | |
| Genetic reagent (plasmid) | pVL847-ornVc D12A | This study | D12A from pDONR cloned into pVL847 for purification of His-MBP-OrnVc D12A, OrnVc D12A | |
| Genetic reagent (plasmid) | pVL847-ornVc L18A | This study | L18A from pDONR cloned into pVL847 for purification of His-MBP-OrnVc L18A, OrnVc L18A | |
| Genetic reagent (plasmid) | pVL847-ornVc D59A | This study | L18A from pDONR cloned into pVL847 for purification of His-MBP-OrnVc D59A, OrnVc D59A | |
| Genetic reagent (plasmid) | pVL847-ornVc Q111A | This study | Q111A from pDONR cloned into pVL847 for purification of His-MBP-OrnVc Q111A, OrnVc Q111A | |
| Genetic reagent (plasmid) | pVL847-ornVc R130A | This study | R130A from pDONR cloned into pVL847 for purification of His-MBP-OrnVc R130A, OrnVc R130A | |
| Genetic reagent (plasmid) | pVL847-ornVc Y129A | This study | Y129A from pDONR cloned into pVL847 for purification of His-MBP-OrnVc Y129A, OrnVc Y129A | |
| Genetic reagent (plasmid) | pVL847-ornVc W61A | This study | W61A from pDONR cloned into pVL847 for purification of His-MBP-OrnVc W61A, OrnVc W61A | |
| Genetic reagent (plasmid) | pVL847-ornVc H66A | This study | H66A from pDONR cloned into pVL847 for purification of His-MBP-OrnVc H66A, OrnVc H66A | |
| Genetic reagent (plasmid) | pVL847-ornVc H158A | This study | H158A from pDONR cloned into pVL847 for purification of His-MBP-OrnVc H158A, OrnVc H158A | |
| Genetic reagent (plasmid) | pMMB-Gn | Fürste et al., 1986; PMID: 3549457 | ||
| Genetic reagent (plasmid) | pMMB-Gn-PA1107 | Kulasakara et al., 2006; PMID: 16477007 | ||
| Genetic reagent (plasmid) | pMMB-Gn-PA1120 | Kulasakara et al., 2006; PMID: 16477007 | ||
| Genetic reagent (plasmid) | pMMB-Gn-PA3702 (wspR) | Kulasakara et al., 2006; PMID: 16477007 | ||
| Genetic reagent (plasmid) | pMMB-Ap | Fürste et al., 1986; PMID: 3549457 | ||
| Genetic reagent (plasmid) | pMMB-Ap-VC0341 (ornVc) | This study | Orn from pDONR cloned into pMMB for expressing in P. aeruginosa | |
| Genetic reagent (plasmid) | pMMB-Ap-ornVc D12A | This study | D12A from pDONR cloned into pMMB for expressing in P. aeruginosa | |
| Genetic reagent (plasmid) | pMMB-Ap-ornVc L18A | This study | L18A from pDONR cloned into pMMB for expressing in P. aeruginosa | |
| Genetic reagent (plasmid) | pMMB-Ap-ornVc Q111A | This study | Q111A from pDONR cloned into pMMB for expressing in P. aeruginosa | |
| Genetic reagent (plasmid) | pMMB-Ap-ornVc R130A | This study | R130A from pDONR cloned into pMMB for expressing in P. aeruginosa | |
| Genetic reagent (plasmid) | pMMB-Ap-ornVc Y129A | This study | Y129A from pDONR cloned into pMMB for expressing in P. aeruginosa | |
| Genetic reagent (plasmid) | pMMB-Ap-ornVc Y129W | This study | Y129W from pDONR cloned into pMMB for expressing in P. aeruginosa | |
| Genetic reagent (plasmid) | pMMB-Ap-ornVc W61A | This study | W61A from pDONR cloned into pMMB for expressing in P. aeruginosa | |
| Genetic reagent (plasmid) | pMMB-Ap-ornVc W61Y | This study | W61Y from pDONR cloned into pMMB for expressing in P. aeruginosa | |
| Genetic reagent (plasmid) | pMMB-Ap-ornVc H66A | This study | H66A from pDONR cloned into pMMB for expressing in P. aeruginosa | |
| Genetic reagent (plasmid) | pMMB-Ap-ornVc H158A | This study | H158A from pDONR cloned into pMMB for expressing in P. aeruginosa | |
| Genetic reagent (plasmid) | pEX-Gn-∆orn (PAK) | This study | ||
| Genetic reagent (plasmid) | pJHA-Gn | This study | ||
| Genetic reagent (plasmid) | pJHA-Gn-ornPa | This study | OrnPA (Orr, et al, PNAS 2015) cloned into pJHA for expressing in P. aeruginosa | |
| Genetic reagent (plasmid) | pJHA-Gn-ornVc | This study | Orn from pDONR cloned into pJHA for expressing in P. aeruginosa | |
| Genetic reagent (plasmid) | pJHA-Gn-ornVc D12A | This study | D12A from pDONR cloned into pJHA for expressing in P. aeruginosa | |
| Genetic reagent (plasmid) | pJHA-Gn-ornVc L18A | This study | L18A from pDONR cloned into pJHA for expressing in P. aeruginosa | |
| Genetic reagent (plasmid) | pJHA-Gn-ornVc D59A | This study | Q111A from pDONR cloned into pJHA for expressing in P. aeruginosa | |
| Genetic reagent (plasmid) | pJHA-Gn-ornVc W61A | This study | R130A from pDONR cloned into pJHA for expressing in P. aeruginosa | |
| Genetic reagent (plasmid) | pJHA-Gn-ornVc H66A | This study | Y129A from pDONR cloned into pJHA for expressing in P. aeruginosa | |
| Genetic reagent (plasmid) | pJHA-Gn-ornVc Q111A | This study | W61A from pDONR cloned into pJHA for expressing in P. aeruginosa | |
| Genetic reagent (plasmid) | pJHA-Gn-ornVc R130A | This study | H66A from pDONR cloned into pJHA for expressing in P. aeruginosa | |
| Genetic reagent (plasmid) | pJHA-Gn-ornVc H158A | This study | H158A from pDONR cloned into pJHA for expressing in P. aeruginosa | |
| Antibody | Mouse anti-HA monoclonal antibody | Sigma; catalog number H9658 | 1:5000 | |
| Antibody | Goat Anti-Mouse IgG-HRP conjugate | Sigma; catalog number A9917 | 1:5000 | |
| DNA fragment | 5'-GGATCCATGGCAGCCGGTGAAAG CATGGCACAGCGTATGGTTTGGGTT GATCTGGAAATGACCGGTCTGGATA TTGAAAAAGATCAGATTATTGAAATG GCCTGCCTGATTACCGATAGCGATCT GAATATTCTGGCAGAAGGTCCGAAT CTGATTATCAAACAGCCGGATGAACT GCTGGATAGCATGAGCGATTGGTGT AAAGAACATCATGGTAAAAGCGGTCT GACCAAAGCAGTTAAAGAAAGCACCA TTACACTGCAGCAGGCCGAATATGAAT TTCTGAGCTTTGTTCGTCAGCAGACC CCTCCGGGTCTGTGTCCGCTGGCAGG TAATAGCGTTCATGAAGATAAAAAGTT TCTGGATAAGTATATGCCGCAGTTTAT GAAGCATCTGCATTATCGCATTATTGAT GTGAGCACCGTTAAAGAACTGTGTCGT CGTTGGTATCCGGAAGAATATGAGTTT GCACCGAAAAAAGCAGCAAGCCATCGT GCACTGGATGATATTAGCGAAAGCATC AAAGAGCTGCAGTTTTATCGCAACAAC ATCTTCAAAAAGAAAATCGACGAGAAAA AACGCAAAATCATCGAAAACGGCGAAAA CGAAAAAACCGTTAGCTAAGCGGCCGC-3' |
GeneArt | custom DNA fragment for REXO2 that is codon-optimized for E. coli | |
| DNA fragment | 5'-GGATCCATGAGCTTTAGCGATCAGAAT CTGATTTGGATTGATCTGGAAATGACCG GTCTGGACCCGGAAATGCATAAAATCAT TGAAATGGCAACCATCGTGACCGATAGCG AACTGAATATTCTGGCAGAAGGTCCGGTT ATTGCAATTCATCAGCCGGAAAGCGAACT GGCAAAAATGGATGAATGGTGTACCACCA CCCATACCGCAAGCGGTCTGGTTGCACGT GTTCGTCAGAGCCAGGTTAGCGAAGAAGA AGCAATTGATCAGACCCTGGCATTTCTGAA ACAGTGGGTTCCGGAAGGTAAAAGCCCGAT TTGTGGTAATAGCATTGGTCAGGATCGTCG CTTTCTGTATAAACATATGCCTCGTCTGGAA GCCTATTTCCATTATCGTTATATTGATGTGAG CACCATCAAAGAACTGACCCGTCGTTGGCAG CCGGAAGTTCTGAAAGAATTTAGCAAAACCG GTAGCCATCTGGCACTGGATGATATTCGTGA AAGCATTGCAGAGCTGCAGTTTTATCGTAAA GCCGTGTTTAAAATCTAAGCGGCCGC-3' |
GeneArt | custom DNA fragment for OrnVc that is codon-optimized for E. coli | |
| RNA primer | 5'-GG-3' | Sigma | ||
| RNA primer | 5'-AGG-3' | Sigma | ||
| RNA primer | 5'-AAGG-3' | Sigma | ||
| RNA primer | 5'-AAAGG-3' | Sigma | ||
| RNA primer | 5'-AAAAGG-3' | Sigma | ||
| RNA primer | 5'-AAAAAGG-3' | Sigma | ||
| RNA primer | 5'-pGG-3' | Biolog; catalog number P023-01 | ||
| RNA primer | 5'-pAA-3' | Biolog; catalog number P033-01 | ||
| RNA primer | 5'-pAG-3' | GE Healthcare Dharmacon | ||
| RNA primer | 5'-pGA-3' | GE Healthcare Dharmacon | ||
| RNA primer | 5'-pGC-3' | GE Healthcare Dharmacon | ||
| RNA primer | 5'-pCG-3' | GE Healthcare Dharmacon | ||
| RNA primer | 5'-pCU-3' | GE Healthcare Dharmacon | ||
| Software | Prism | GraphPad | ||
| Software | XDS | Kabsch, 2010; PMID: 20124693 | Distributed through SBGrid | |
| Software | Pointless | Evans, 2006; PMID: 16369096 | Distributed through SBGrid | |
| Software | Scala | Evans, 2006; PMID: 16369096 | Distributed through SBGrid | |
| Software | Phenix | Adams et al., 2010; PMID: 20124702 | Distributed through SBGrid | |
| Software | Coot | Emsley et al., 2010; PMID: 20383002 | Distributed through SBGrid | |
| Software | Pymol | Schrödinger | ||
| Software | Fujifilm Multi Gauge software v3.0 | Fujifilm |