Table 2. Thermodynamic parameters, secondary structures and product size of the primers and probes designed to specifically detect Clavibacter michiganensis and C. michiganensis subsp. nebraskensis.
| Target | Primer name | Primer sequences (5’-3’) | Length (bp) |
TM (°C)b | GC% | ΔGc | Anyd | 3’d | Query cover (%)e | Identity (%)e | Product size (bp) |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Clavibacter michiganensis | CM-F1 | ACTCAGAGGTCCTGGGCAAA | 20 | 60.8 | 55.0 | 0.7 | 5.0 | 0.0 | 100 | 100 | 107 |
| CM-R1 | CTCTGGGTGTACGGGTTCAT | 20 | 59.1 | 55.0 | 0.9 | 4.0 | 2.0 | 100 | 100 | ||
| CM-F1_wfa | AAATTATCTTTACTCAGAGGTCCTGGGCAAA | 31 | 64.1 | 40.0 | 0.9 | 5.0 | 4.0 | ‒ | ‒ | 129 | |
| CM-R1_wfa | AAACTTATTTTCTCTGGGTGTACGGGTTCAT | 31 | 64.7 | 38.7 | 1.0 | 5.0 | 2.0 | ‒ | ‒ | ||
| CM-P | Cy5/TCCAGCTTC/TAO/TTGAAGACGAGCTGC/RQ-Sp | 24 | 65.2 | 54.2 | 0.4 | 7.0 | 3.0 | 100 | 100 | ||
| C. m. subsp. nebraskensis | Cmn-F11 | TGCACCTTCATCACGACATGG | 21 | 61.5 | 52.4 | 1.0 | 4.0 | 2.0 | 100 | 100 | 151 |
| Cmn-R11 | ACGATGATCATGCTGGCAATG | 21 | 59.4 | 47.6 | 0.9 | 8.0 | 4.0 | 100 | 100 | ||
| Cmn-F11_wfa | AAATATTTCTTGCACCTTCATCACGACATGG | 31 | 65.0 | 38.7 | 1.0 | 8.0 | 2.0 | ‒ | ‒ | 171 | |
| Cmn-R11_wfa | AATTATCTCTACGATGATCATGCTGGCAATG | 31 | 63.8 | 38.7 | 0.9 | 8.0 | 4.0 | ‒ | ‒ | ||
| Cmn11-P | 6FAM/TGTTCGGTC/ZEN/TCGTCATCGCACGGCA/FQ | 25 | 70.5 | 60.0 | 1.0 | 4.0 | 0.0 | 100 | 100 |
aFlap primers with 5’ AT -rich nucleotides (bold letters)
bannealing temperature (TM) of the primers were calculated using Primer3 Plus
cΔG value (kcal/mol) in plot calculated using mFold
dSelf-complementary and 3’ self-complementary scores (Any and 3’, respectively) of the oligos calculated using Primer3 Plus.
eQuery cover and Identity (%) of the oligos were calculated using BLASTn.