REAGENT or RESOURCE | SOURCE | IDENTIFIER |
---|---|---|
Antibodies | ||
anti-RELMα | Life Span | Cat# LS-C104472; RRID:AB_2180030 |
anti-RETN | Life Span | Cat# LS-C131843–100; RRID:AB_10834395 |
anti-RELMα | Abcam | Cat# ab39626, RRID:AB_777652 |
Alexa Fluor® 594 secondary antibody | Thermo Fisher Scientific | Cat# R37119, RRID:AB_2556547 |
Anti-Actin | Sigma-Aldrich | Cat# A5060, RRID:AB_476738 |
Bacterial and Virus Strains | ||
Staphylococcus aureus | ATCC | ATCC 25923 |
Escherichia coli K-12 | ATCC | ATC-PTA-7555 |
Pseudomonas aeruginosa | ATCC | ATCC 27853 |
Listeria monocytogenes, EGD-e | BD Biosciences | BD# 237500 |
Staphylococcus epidermidis, clinical isolate | Hooper Lab | N/A |
Streptococcus pyogenes | ATCC | ATCC12384 |
Propionibacterium acnes | ATCC | ATCC 6919 |
Staphylococcus aureus (parent strain) | Dr. George Liu | N/A |
Staphylococcus aureus (ΔCRTM) | Dr. George Liu | N/A |
Citrobacter rodentium, DBS100 | ATCC | ATCC 51459 |
Biological Samples | ||
Human skin tissue-Control samples | UT Southwestern Tissue Bank/PI: Ben Chong M.D. | STU 082010–241 |
Chemicals, Peptides, and Recombinant Proteins | ||
RIPA buffer | Thermo Fisher Scientific | Cat# 89900 |
DAPI Fluoromount-G® | Southern Biotechnology | Cat# 0100–2 |
cOmplete™ Protease Inhibitor Cocktail | Sigma-Aldrich | Cat# 11697498001 |
Sebomed® Basal Medium | Merck | Cat# F8205 |
Fetal Bovine Serum | Gibco | Cat# 10082147 |
Retinol | Sigma-Aldrich | Cat# R7632 |
IL-1β | Thermo Fisher Scientific | Cat# 10139HNAE |
BMS493 | TOCRIS | Cat# 3509 |
Magna protein A beads | Millipore | Cat#16–661 |
Vitamin A Deficient Diet | ENVIGO | TD.09838 |
Control diet (to Vitamin A) | ENVIGO | TD.09839 |
13-cis retinoic acid | Sigma-Aldrich | Cat# R3255 |
Corn oil | Sigma-Aldrich | Cat# C8267 |
One Shot TOP10 competent cells | Thermo Fisher Scientific | Cat# C404010 |
BL21 DE3RIL cells | Agilent | Cat#230245 |
chicken lysozyme | LS-Bio | LS-G132095–1 |
1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine or POPC | AVANTI | Cat #850457C |
1,2-dioleoyl-sn-glycero-3-phospho-L-serine or DOPS | AVANTI | Cat #840035C |
cholesterol (ovine) | AVANTI | Cat # 700000 |
PD-10 Column | Sigma-Aldrich | GE17-0851-01 |
5(6)-carboxyfluorescein | Sigma-Aldrich | Cat # 21877 |
n-octylglucoside | Anatrace | Cat # O311 |
propidium iodide (PI) | Thermo Fisher Scientific | Cat# P3566 |
96-well Costar plates | Fisher | Cat # 07-200-567 |
Ni-NTA column | Qiagen | Cat#30210 |
Nair Depilatory cream | Nair | N/A |
S. aureus selective plates | Hardy Diagnostics | Cat#A70 |
CHROMagar™ Staph aureus | BBL™ | Cat# 214982 |
Agencourt AmpureXP beads | Beckman Counter Genomics | Cat# A63881 |
15-blade scalpel | Fine Scientific Tools | Cat#10115–10 |
Tegaderm | 3M 9505W | Cat# 3M 9505W |
Band-Aid Sheer Strips | BAND-AID | N/A |
Andis ProClip | ProClip | N/A |
human epidermal growth factor | Thermo Fisher Scientific | Cat# PHG0313 |
Critical Commercial Assays | ||
TruSeq ChIP Sample Prep Kit | Illumina | Cat# IP-202–1012 |
RNAeasy Plus universal kit | Qiagen | Cat# 73404 |
LA Taq Hot Start polymerase kit | Takara | Cat# RR042B |
mini-extruder kit | Avanti Polar Lipids | Cat #610000 |
Truseq RNA sample preparation kit v2 | Illumina | Cat#-RS-122–2001 |
High Capacity cDNA reverse transcription kit | Thermo Fisher Scientific | Cat# 4368814 |
KOD Hot Start Polymerase kit | Millipore | Cat #71086 |
QIAprep Spin Miniprep kit | Qiagen | Cat#27106 |
Agencourt Ampure XP kit | Beckman Counter Genomics | Cat# A63881 |
QuantIT dsDNA High-Sensitivity Assay kit | Thermo Fisher Scientific | Cat#Q33120 |
MinElute PCR Purification Kit | Qiagen | Cat#28006 |
PE300 (Paired end 300 bp) v3 kit | Illumina | Cat# MS-102–3001 |
Quick PCR purification kit | Qiagen | Cat# 28104 |
Deposited Data | ||
RNA-seq data | This paper | GEO: GSE108718 https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE108718 |
16S rRNA skin data | This paper | (SRA) BioProject ID PRJNA527213 https://www.ncbi.nlm.nih.gov/bioproject |
16S rRNA fecal data | This paper | (SRA) BioProject ID PRJNA528925 http://www.ncbi.nlm.nih.gov/bioproject/528925 |
Experimental Models: Cell Lines | ||
SZ95 Cell Line | Christos Zouboulis | RRID:CVCL_9803 |
Experimental Models: Organisms/Strains | ||
Mouse: C57BL/6 | UT Southwestern | RRID: IMSR_JAX:008471 |
Mouse: Retnla−/− | This paper | N/A |
Oligonucleotides | ||
Real-time quantitative PCR primers | Thermo Fisher Scientific | Table S1 |
Chromatin immunoprecipitation (ChIP) assay primers | Integrated DNA Technologies | Table S2 |
mRELMα expression cloning Forward Primer GGATACCATATGGATGAAACGATCGAAATCATCG |
Integrated DNA Technologies | Custom Primer |
mRELMα expression cloning Reverse Primer GATGATGGATCCTTAAGACAGTTGACAGCAGCGGGC |
Integrated DNA Technologies | Custom Primer |
hRETN expression cloning Forward Primer GGATACCATATGCGCTCTAAAACCCTGTGTTCC |
Integrated DNA Technologies | Custom Primer |
hRETN expression cloning Reverse Primer GATGATGGATCCTTACGGTTGAACACGACAGCAACG |
Integrated DNA Technologies | Custom Primer |
RETN-FISH: spanning exon 2 and exon 3 of the human Retn mRNA. 5’-/5Alexa594N/GCT TAT TGC CCT AAA TAT TAG GGA GCC GGC GAC CTC C/3Alexa594n/-3’ |
Integrated DNA Technologies | Custom Oligonucleotide |
Defa5-FISH: 5’-/5Alexa488N/CTG GTC CTC TTC CCC TGG CTG CTC CTC AGT ATT AGT/3Alexa488n/-3’ |
Integrated DNA Technologies | Custom Oligonucleotide |
Retnla-FISH: spanning exon 2 and exon 3 of the mouse Retnla mRNA 5’-/5Alexa594N/CAG TGG AGG GAT AGT TAG CTG GAT TGG CAA GAA GTT CC/3Alexa94n/-3’ |
Integrated DNA Technologies | Custom Oligonucleotide |
16S V1 (primer 27 F; 5′-AGAGTTTGATCCTGGCTCAG-3′) | (Grice et al., 2008) | N/A |
16S V3 (primer 534 R; 5′-ATTACCGCGGCTGCTGG-3′) | (Grice et al., 2008) | N/A |
Recombinant DNA | ||
pET28a expression vector | Millipore | Cat#69864 |
Software and Algorithms | ||
Fiji (ImageJ) | http://fiji.sc | RRID:SCR_002285 |
GraphPad PRISM | GraphPad Software | Version 7.0; RRID:SCR_002798 |
TopHat | Top Hat | Version 2.1.1; RRID:SCR_013035 |
Mothur | Mothur | RRID:SCR_011947 |
UCHIME | UCHIME | RRID:SCR_008057 |
Illumina Nextera protocol | Illumina | Part # 15044223 Rev. B |
CLC Bio Microbial Genomics Module | Qiagen |
https://www.qiagenbioinformatics.com/plugins/clc-microbial-genomics-module/). |
Image Lab Software | BioRad | RRID:SCR_014210 |
Other | ||
Bio-Rad ChemiDoc™ Touch system | BioRad | Cat# 1708370 |
Zeiss Axio Imager M1 microscope | Zeis | N/A |
Discover Echo REVOVLE 4 | Discover Echo | N/A |
QuantStudio 7 Flex Real-Time PCR System | Applied Biosystems | Cat# 4485701 |
Agilent 2100 Bioanalyzer | Agilent | G2939A |
Ultrasonic Cell Disruptor | Misonix | N/A |
Amicon Ultra centrifugal filters | Millipore | Cat#UFC900324 |
Superdex 75/300 | GE Healthcare | Cat #17-5174-01 |
PTI-QuantaMaster 300 fluorometer | Horiba | N/A |
Spectramax plate reader | Molecular Devices | N/A |
Illumina MiSeq platform | Illumina | RRID:SCR_016379 |
Illumina HiSeq 2500 | Illumina | RRID:SCR_016383 |