Figure - PMC

Skip to main content

An official website of the United States government

Here's how you know

Here's how you know

Official websites use .gov
A .gov website belongs to an official government organization in the United States.

Secure .gov websites use HTTPS
A lock ( ) or https:// means you've safely connected to the .gov website. Share sensitive information only on official, secure websites.

View full-text article in PMC

. 2019 May 28;7(2):46. doi: 10.3390/vaccines7020046

Search in PMC
Search in PubMed
View in NLM Catalog
Add to search

© 2019 by the authors.

Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).

PMC Copyright notice

Construction of pMP-H1/RBD and characterization of the secreted OMVs-H1/RBD. (a) Schematic representation of the outer-membrane vesicles (OMVs)-vaccination platform to combat MERS-CoV and pandemic 2009 H1N1 (H1N1pdm09). The target sequences of MERS-CoV (RBD, 720 bp, 240 aa) and H1N1pdm09 (HA) were amplified, purified, digested and ligated to pMPccdB vector. The ligated plasmids harboring the target sequences were transformed into bacteria and the secreted OMVs containing recombinant antigens were then purified for evaluation in mice. Abbreviations: NCR: Non-coding region, SP: Signal peptide, RBD: Receptor binding domain (MERS-CoV), L: Nucleotide sequence of peptide linker (GGTAGCGCCGGTAGCGCCGGA), HA1: Hemagglutinin 1, and HA2: Hemagglutinin 2. (b) Immunoblotting pattern of OMVs, extracted either from various control/non-transformed OMVs (C1, C2, and C3) (empty OMVs) or pMP-H1/RBD-transformed (OMVs-H1/RBD) DH10ß (S1-S6), against antiserum of swine HA1 antibody.