Table 1.
Bacterial strains, plasmids and oligonucleotides used in this study
| Strain | Genotype/relevant characteristics | Reference or source |
|---|---|---|
| Pseudomonas corrugata | ||
| CFBP 5454 | Wild‐type, source of crpC and crpD | CFBP |
| PCOMFP | crpD:: pKnock, Kmr | This study |
| PCONRPS | crpC:: pknock, Kmr | This study |
| PCOMFPC | PCOMFP complemented with pBBR‐CrpDE | This study |
| GL2 | pcoR76::Tn5, Kmr | Licciardello et al. (2007) |
| GLRFIA | rfiA:: pKnock, Kmr | Licciardello et al. (2009) |
| Escherichia coli | ||
| pLC3.34 | pLAFR3 containing P. corrugata CFBP 5454 DNA, Tcr | DISPA |
| DH5α | F2 f80dlaczZDM15 D(lacZYA‐argF)U169 endA1 recA1 hsdR17 deoR gyrA96 thi‐1 relA1 supE44 | Sambrook et al. (1989) |
| CC118λpir | Δ(ara, leu)7697 araD139 ΔlacX74 galE galK phoA20 thi‐1 rpsE rpoB (Rfr) argE(Am) recA1 λpir | Herrero et al. (1990) |
| Chromobacterium violaceum | ||
| CV026 | ATCC 31532 derivative, cviI::Tn5xylE Kmr Smr | McClean et al. (1997) |
| Plasmids | ||
| pCR2.1 | Cloning vector TA, Ampr | Invitrogen |
| pGEM‐T | Cloning vector TA, Ampr | Promega |
| pKNOCK‐Kmr | Mobilizable suicide vector, Kmr | Alexeyev (1999) |
| pRK2013 | Kmr100, Tra+ Mob+ ColE1 replicon | Figurski and Helinski (1979) |
| pKMMfp | pKNOCK containing an internal fragment of P. corrugata CFBP 5454 corpD gene | This study |
| pKMNrps | pKNOCK containing an internal fragment of P. corrugata CFBP 5454 corpC gene | This study |
| pBBR‐CrpDE | pBBR1MCS‐5 containing the full‐length P. corrugata CFBP 5454 crpDE genes | This study |
| Oligonucleotides | Sequence | |
| MFPkn‐fw | 5′‐AAGGATCCAGTGGCTGGCGGAAATC‐3′ | This study |
| MFPkn‐rev | 5′‐GGTCTAGAGGATGGTGAAATACACT‐3′ | This study |
| NRPSkn‐fw | 5′‐CAGGATCCGGATCTATCTGCTCGAC‐3′ | This study |
| NRPSkn‐rev | 5′‐AATCTAGAGCCGATAGTGCCGAGGG‐3′ | This study |
| PCR1‐fw | 5′‐ACCGCAACATCAATACAGCG‐3′ | This study |
| PCR1‐rev | 5′‐ACCGACATCAACCTGCTTGAC‐3′ | This study |
| PCR2‐fw | 5′‐CATCGCCTGCGTATCTCGAT‐3′ | This study |
| PCR2‐rev | 5′‐CAACTCATGGTCGTCCATCG‐3′ | This study |
| Pco16S fw | 5′‐TGTAGCGGTGAAATGCGTAGAT‐3′ | Conte et al. (2006) |
| Pco16S rev | 5′‐CCTCAGTGTCAGTATCAGTCCAG‐3′ | Conte et al. (2006) |
| Abc1‐fw | 5′‐CAAAATCGCTATCGTGCTTGTC‐3′ | This study |
| Abc1‐rev | 5′‐CGACCGTAGCGGTCAGGTA‐3′ | This study |
| Nrps‐fw | 5′‐ACGGGCCACCCGAAAG‐3′ | This study |
| Nrps rev | 5′‐GAGGCGAAAGCCACGTGAT‐3′ | This study |
| ABC‐fw | 5′‐AAGCTTTGGGCACACCCATG‐3′ | This study |
| ABC‐rev | 5′‐GGATCCCACAGAGGACAGTG‐3′ | This study |
| Primerseq‐fw | 5′‐GATCCATCGACGGACTGTC‐3′ | This study |
| Primerseq‐rev | 5′‐CATCGTGTTCGGTTTCGTAC‐3′ | This study |
CFBP, Collection Francaise de Bacteries Phytopathogenes, Angers, France; DISPA, Dipartimento di Scienze delle Produzioni Agrarie ed Alimentari, University of Catania, Catania, Italy.