X22‐B (= X22A‐1) |
A HindIII/XhoI fragment from plasmid pUC X22‐B Bcl which contains DNA adjacent to a T‐DNA insert in a transgenic line of Forge. The T‐DNA contains an Activator (Ac) transposable element plus a neomycin phosphotransferase (NPT‐II) gene (Ellis et al., 1995) |
Probe hybridizes to a single fragment. In a test‐cross family of 52 individuals, no recombinants were observed between M and RFLP marker (T‐DNA not present). In test‐crosses segregating for NPT‐II in the M‐linked T‐DNA and either the M, M1 or M3 resistance genes, the number of recombinants/family size was: |
|
M—NPT‐II 6/339 |
|
M1—NPT‐II 1/320 |
|
M3—NPT‐II 2/316 |
Mxb‐1 |
An Xba1 fragment of ∼700 bp derived from a region ∼1 kb downstream of the M gene (Anderson et al., 1997) |
Probe hybridizes (EcoRI digest) to single fragment in Dakota (M), Williston Brown (M1), Victory A (M4) and Hoshangabad and to two fragments in Ward (M2), Cass (M3) and the M6 line. Apparently M locus‐specific marker |
M3.2/5 |
A 791‐bp polymerase chain reaction (PCR)‐amplified fragment derived from a gene ∼2 kb upstream of M3. |
Probe hybridizes to two fragments: one is located near the M locus (no recombinants with M in 52 test‐cross progeny), the other is located near the L locus (two recombinants with L6 in 52 test‐cross progeny) |
Amplified using primers M3.2 (5′‐GAAAGAAGCAATAGATGAACTG‐3′) and M3.5 (5′‐GATTCGGAAAGGGAGACCG‐3′) |
Lu‐2 |
A HindIII/BglII fragment of ∼1.6 kb located ∼2 kb upstream of the L6 gene (Ellis et al., 1995). HindIII end of fragment has homology to glycogenin glucosyltransferase gene in rice |
Probe hybridizes to two fragments, one of which is located at the L locus and the other at the M locus (Ellis et al., 1995) |
Lu‐3 |
An EcoRI/BglII fragment of ∼1.1 kb from the leucine‐rich repeat (LRR) region of the L6 gene (Ellis et al., 1995; Lawrence et al., 1995) |
Probe hybridizes to up to 15 restriction fragments. Fragments originate from only two locations, the L and M loci (Anderson et al., 1997). Single polymorphic fragment maps to L locus, multiple polymorphic fragments map to M locus (Ellis et al., 1995; this paper) |