TABLE 2.
Bacterial strains, plasmids, and primers used in this study
| Plasmid, bacterial strain, or primer | Gene accession no. | Description (genotype and/or relevant characteristic[s]) or sequence of oligonucleotide primer | Reference or source |
|---|---|---|---|
| E. coli bacterial strains | |||
| WT | BW25113; rrnB3 ΔlacZ4787 hsdR514 Δ(araBAD)567 Δ(rhaBAD)568 rph-1 | 49 | |
| ΔfsaA | b0825 | BW25113 ΔfsaA::frt | This study |
| ΔfsaB | b3946 | BW25113 ΔfsaB::frt | This study |
| ΔgldA | b3945 | BW25113 ΔgldA::frt | This study |
| ΔglpK | b3926 | BW25113 ΔglpK::frt | This study |
| ΔdhaKLM | b1200, b1199, b1198 | BW25113 ΔdhaKLM::frt | This study |
| ΔptsA::kan | b3947 | BW25113 ΔptsA::kan | 49 |
| ΔptsA | b3947 | BW25113 ΔptsA::frt | This study |
| WT+p131 | BW25113 + pSEVA131 | This study | |
| WT+p234 | BW25113 + pSEVA234 | This study | |
| fsaA+++ | b0825 | BW25113 + pSEVA234-fsaA | This study |
| fsaB+++ | b3946 | BW25113 + pSEVA131-fsaB | This study |
| gldA+++ | b3945 | BW25113 + pSEVA131-gldA | This study |
| glpK+++ | b3926 | BW25113 + pSEVA131-glpK | This study |
| dhaKLM+++ | b1200, b1199, b1198 | BW25113 + pSEVA131-dhaKLM | This study |
| ΔfsaA+++ | b0825 | ∆fsaA + pSEVA234-fsaA | This study |
| ΔfsaB+++ | b3946 | ∆fsaB + pSEVA131-fsaB | This study |
| ΔgldA+++ | b3945 | ∆gldA + pSEVA131-gldA | This study |
| ΔglpK+++ | b3926 | ∆glpK + pSEVA131-glpK | This study |
| ΔdhaKLM+++ | b1200, b1199, b1198 | ∆dhaKLM + pSEVA131-dhaKLM | This study |
| Plasmids | |||
| pSEVA131 | Medium copy number, lacIq/Ptrc promotor, pBBR1 ori, Ampr; original pSEVA131 plasmid does not contain a promotor | 66 | |
| pSEVA234 | Medium copy number, lacIq/Ptrc promotor, pBBR1 ori, Kmr | 67 | |
| pSEVA131-dhaKLM | Derivative of pSEVA-131 containing dhaKLM operon; used to overexpress dhaKLM in BW25113 | This study | |
| pSEVA131-fsaB | Derivative of pSEVA-131 containing fsaB gene; used to overexpress fsaB in BW25113 | This study | |
| pSEVA131-gldA | Derivative of pSEVA-131 containing gldA gene; used to overexpress gldA in BW25113 | This study | |
| pSEVA131-glpK | Derivative of pSEVA-131 containing glpK gene; used to overexpress glpK in BW25113 | This study | |
| pSEVA234-fsaA | Derivative of pSEVA-234 containing fsaA gene; used to overexpress fsaA in BW25113 | This study | |
| Primers | |||
| dhaKLM_knockout_F | CGTGTCGTTGAACATCATCCATGCCCTACCGTAATTGCTGGAGCAAAATAGTGTAGGCTGGAGCTGCTTC | ||
| dhaKLM_knockout_R | CATCAGAACGATGCCATCCGAACAGTGGCTTAACCCTGACGGTTGAAACGCATATGAATATCCTCCTTAG | ||
| glpK_knockout_F | TCCTTCAGAACAAAAAGCTTCGCTGTAATATGACTACGGGACAATTAA ACGTGTAGGCTGGAGCTGCTTC |
||
| glpK_knockout_R | ACGTTTCGGGACTACCGGATGCGGCATAAACGCTTCATTCGGCATTTACACATATGAATATCCTCCTTAG | ||
| Cm_F | AATCGTCGTGGTATTCACTCC |