Table 3.
Sequences of oligonucleotides. The listed oligonucleotide pairs were used in quantitative real‐time PCR experiments, while Β‐actin and Cyclophilin served as reference genes. The predicted amplicon sizes are given
| Gene | Forward (F) and reverse (R) oligonucleotides | GenBank acc. no. | Amplicon size |
|---|---|---|---|
|
Β‐actin‐F Β‐actin‐R |
ctaaggccaaccgtgaaag accagaggcatacagggaca |
NM_007393.5 | 104 bp |
|
Cyclophilin‐F Cyclophilin‐R |
ttcttcataaccacaagtcaagacc tccacctccgtaccacatc |
M60456.1 | 95 bp |
|
Gfap‐F Gfap‐R |
acagactttctccaacctccag ccttctgacacggatttggt |
NM_010277.3 | 63 bp |
|
Opsin‐F Opsin‐R |
ccgctatctgaagatctgttatctg tgccaggcagatgtaggc |
AY318865.1 | 73 bp |
|
Pkcα‐F Pkcα‐R |
caagggatgaaatgtgacacc cctcttctctgtgtgatccattc |
NM_011101.3 | 96 bp |
|
Pou4f1‐F Pou4f1‐R |
ctccctgagcacaagtaccc ctggcgaagaggttgctc |
AY706205.1 | 98 bp |
|
Recoverin‐F Recoverin‐R |
caatgggaccatcagcaaa cctaggcttgatcattttga |
NM_009038.2 | 71 bp |
|
Rhodopsin‐F Rhodopsin‐R |
tgtggtcttcacctggatcat gaacattgcatgccctcag |
NM_145383.1 | 90 bp |
Abbreviations: F, forward; R, reverse; acc. no, accession number; bp, base pair.