KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rabbit polyclonal anti-histone H3 | Abcam | Cat# ab1791; RRID: AB_302613 |
| Rabbit polyclonal anti-histone H4 | Abcam | Cat# ab10158; RRID: AB_296888 |
| Rabbit polyclonal anti-histone H2B | Abcam | Cat# ab1790; RRID: AB_302612 |
| Mouse monoclonal anti-tubulin | DSHB | Cat# E7-c |
| Rabbit polyclonal Alexa Fluor® 488 | Thermo Fisher Scientific | Cat# A11034; RRID: AB_2576217 |
| Rabbit polyclonal IRDye® 680RD | LI-COR | Cat# 926–68071; RRID: AB_10956166 |
| Mouse monoclonal IRDye® 800RD | LI-COR | Cat# 926–32210; RRID: AB_621842 |
| Streptavidin-HRP | Pierce | Cat# 21130 |
| SuperSignal West POCO Plus | Invitrogen | Cat# 34577 |
| RNeasy Minelute Cleanup Kit | Qiagen | Cat# 74204 |
| Western Blocking Reagent | Roche | Cat# 11921673001 |
| Click-iT™ Nascent RNA Capture Kit | Thermo Fisher Scientific | Cat# C10365 |
| Ovation® Human FFPE RNA-Seq Multiplex System 1–8 | NuGEN | Cat# 0340 |
| Agilent High Sensitivity DNA Kit | Agilent | Cat# 5067–4626 |
| SPRIselect Reagent | Beckman Coulter | Cat# B23317 |
| NEBNext® Library Quant Kit for Illumina® | NEB | Cat# E7630 |
| NSQ 500/550 Hi Output KT v2.5 (75 CYS) | Illumina | Cat# 20024906 |
| Biological Samples | ||
| Xenopus laevis embryos | This paper | N/A |
| Chemicals, Peptides, and Recombinant Proteins | ||
| 5-Ethynyl Uridine (5-EU) | Thermo Fisher Scientific | Cat# E 10345 |
| Tetramethylrhodamine (TAMRA)-azide | Abcam | Cat# ab146486 |
| Biotin azide (PEG4 carboxamide-6-azidohexanyl biotin) | Thermo Fisher Scientific | Cat# C 10365 (component in Click-iT™ Nascent RNA Capture Kit) |
| Ascorbic acid | Sigma | Cat# A7506 |
| CuSO4 | Sigma | Cat# 61230 |
| TO-PRO-3 | Thermo Fisher Scientific | Cat# T3605 |
| Paraformaldehyde | EMS | Cat#15710-S |
| Ficoll® 400 | Sigma | Cat# F4375 |
| Hydrogen peroxide | Sigma | Cat# H1009 |
| Formamide | Thermo Fisher Scientific | Cat# AC181090010 |
| Benzyl alcohol | Sigma | Cat# 305197 |
| Benzyl benzoate | ACROS Organics | Cat# 105860010 |
| Experimental Models: Organisms/Strains | ||
| Xenopus laevis embryos | This paper | N/A |
| Oligonucleotides | ||
| Ode Fwd 5’ GAT CAT GCA CAT GTC AAG CC 3’ | This paper | N/A |
| Ode Rev 5’ TCT ACG ATC GAT CCA GCC 3’ | This paper | N/A |
| Gs17 Fwd 5’ CAGCCATGGAAAGACTGGT 3’ | This paper | N/A |
| Gs17 Rev 5’ TGGGTTCTGGAGTACGTTTATG 3’ | This paper | N/A |
| Id3 Fwd GAGCAGAGTCTGAGCATTG | This paper | N/A |
| Id3 Rev GAGTAGCAGCCGTTCATATC | This paper | N/A |
| Bix 1.2 Fwd 5’ ACAGCAACAAGTCCAACCCA 3’ | This paper | N/A |
| Bix 1.2 Rev 5’ CCCATGAGGATTCAGGGCAA 3’ | This paper | N/A |
| Chordin Fwd 5’ TGGGAGCAGTATAGGGTTAG 3’ | This paper | N/A |
| Chordin Rev 5’ GGGAACCATTCGGAGTTATG 3’ | This paper | N/A |
| Software and Algorithms | ||
| ImageJ Version 2.0.0 | NIH | https://imagej.nih.gov/ij/ |
| GraphPad Prism 7 | GraphPad | N/A |
| Imaris 9.2 | Bitplane | N/A |
| Adobe Illustrator CC 2017 | Adobe | N/A |
| OriginPro2017 | OriginLab | N/A |
| Excel 2017 | Microsoft | N/A |
| RStudio | RStudio Inc | https://www.rstudio.com |
| Python 3 | Jupyter notebook | http://jupyter.org |
| MATLAB | MathWorks | N/A |
CONTACT FOR REAGENT AND RESOURCE SHARING
Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Matthew Good (mattgood@pennmedicine.upenn.edu).