Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (M. musculus) | Shhf/f | Jackson Laboratories | RRID:MGI:2165468 | |
| Genetic reagent (M. musculus) | Olig2-Cre | PMID: 18046410 | Dr. Bennett G. Novitch (University of California, Los Angeles) | |
| Genetic reagent (M. musculus) | Arhgap36-/- | This paper | Exon2 targetting sgRNA made by ToolGEN, injected by KRIBB | |
| Transfected construct (M. musculus) | Arhgap36-(enhancer)2:LUC | This paper | Arhgap36 enhancer containing HxRE sequence cloned into TK-LUC vector | |
| Transfected construct (M. musculus) | Arhgap36-(enhancer)2:GFP | This paper | Arhgap36 enhancer containing HxRE sequence cloned into TATA-GFP vector | |
| Transfected construct (R. norvegicus) | Isl1 | PMID: 22343290 | ||
| Transfected construct (M. musculus) | Lhx3 | PMID: 22343290 | ||
| Transfected construct (E. coli) | β-galactosidase | PMID: 22343290 | ||
| Transfected construct (M. musculus) | Arhgap36 | Open Biosystems | Accession: BC145645 | |
| Transfected construct (M. musculus) | PKA WT | PMID: 23644383 | ||
| Transfected construct (M. musculus) | PKA K73H | PMID: 23644383 | ||
| Transfected construct (M. musculus) | AKT2 CA | Addgene | RRID:Addgene_9016 | myristoylated form |
| Transfected construct (M. musculus) | AKT2 DN | Addgene | RRID:Addgene_60128 | |
| Sequence-based reagent | Shh shRNA_sense strand | This paper | PCR primers | GAT CCA AGC TCT TCT ACG TCA TCG TTC AAG AGA CGA TGA CGT AGA AGA GCT TTT TTT A |
| Sequence-based reagent | Shh shRNA_antisense strand | This paper | PCR primers | AGC TTA AAA AAA GCT CTT CTA CGT CAT CGT CTC TTG AAC GAT GAC GTA GAA GAG CTT G |
| Sequence-based reagent | Arhgap36 enhancer_F | This paper | PCR primers | ACTGCCTATTCGCATCGGCCTTTGA, for cloning |
| Sequence-based reagent | Arhgap36 enhancer_R | This paper | PCR primers | TTCTGCGGAGCCATTAGTGCGATTG, for cloning |
| Sequence-based reagent | mouse Arhgap36_F | This paper | PCR primers | TGG GAT CCA AGA GGA AGA TG, for RT-PCR |
| Sequence-based reagent | mouse Arhgap36_R | This paper | PCR primers | CAG CCA CAT CAT GGA CAT TC, for RT-PCR |
| Sequence-based reagent | mouse Cyclophilin A_F | This paper | PCR primers | GTC TCC TTC GAG CTG TTT GC, for RT-PCR |
| Sequence-based reagent | mouse Cyclophilin A_R | This paper | PCR primers | GAT GCC AGG ACC TGT ATG CT, for RT-PCR |
| Sequence-based reagent | mouse Arhgap36 enhancer_F | This paper | PCR primers | ACC TTG TAG CAG GAC TGG GGT, for ChIP |
| Sequence-based reagent | mouse Arhgap36 enhancer_R | This paper | PCR primers | AGC CAT TAG TGC GAT TGC TCT, for ChIP |
| Sequence-based reagent | Untr6_F | PMID: 18854042 | PCR primers | TCA GGC ATG AAC CAC CAT AC, for ChIP |
| Sequence-based reagent | Untr6_R | PMID: 18854042 | PCR primers | AAC ATC CAC ACG TCC AGT GA, for ChIP |
| Antibody | anti-Hb9/MNR2 (Mouse) | DSHB | DSHB Cat# 81.5C10, RRID:AB_2145209 | IHC, 1:500 |
| Antibody | anti-Isl1 (Rabbit monoclonal) |
Abcam | Abcam Cat# ab109517, RRID:AB_10866454 | IHC, 1:2000 |
| Antibody | anti-FoxP1 (Rabbit polyclonal) |
Abcam | Abcam Cat# ab16645, RRID:AB_732428 | IHC, 1:1000 |
| Antibody | anti-Nkx2.2 (Mouse monoclonal) |
DSHB | DSHB Cat# 74.5A5, RRID:AB_531794 | IHC, 1:100 |
| Antibody | anti-Pax6 (Mouse monoclonal) |
DSHB | DSHB Cat# pax6, RRID:AB_528427 | IHC, 1:500 |
| Antibody | anti-Olig2 (Rabbit polyclonal) |
Abcam | Millipore Cat# AB15328, RRID:AB_2299035 | IHC, 1:1000 |
| Antibody | anti-β-gal (Chicken polyclonal) |
Abcam | Abcam Cat# ab9361, RRID:AB_307210 | IHC, 1:5000 |
| Antibody | anti-Lhx3 (Rabbit polyclonal) |
Abcam | Abcam Cat# ab14555, RRID:AB_301332 | IHC, 1:500 |
| Antibody | anti-nNOS (Rabbit polyclonal) |
Immunostar | ImmunoStar Cat# 24287, RRID:AB_572256 | IHC, 1:1000 |
| Antibody | anti-Chx10 (Guinea pig polyclonal) | PMID: 18539116 | IHC, 1:1000 | |
| Antibody | anti-GFP (Rabbit polyclonal) |
Life Technologies | Thermo Fisher Scientific Cat# A-11122, RRID:AB_221569 | IHC, 1:1000 |
| Antibody | anti-Hb9 (Guinea pig polyclonal) |
PMID: 30177510 | IHC, 1:1000 rat Hb9 C-terminus (234–403 aa |
|
| Antibody | anti-ARHGAP36 (Rabbit polyclonal) |
This paper | IHC, 1:2000 mouse ARHGAP36(201–590 aa) |
|
| Antibody | anti-HA (Mouse monoclonal) | Covance | Covance Research Products Inc Cat# MMS-101R-500, RRID:AB_10063630 | IP, IB, 1:5000 |
| Antibody | anti-Gli3 (Goat polyclonal) |
R and D Systems | R and D Systems Cat# AF3690, RRID:AB_2232499 | IB, 1:250 |
| Antibody | anti-ARHGAP36 (Rabbit polyclonal) | Sigma-Aldrich | Sigma-Aldrich Cat# HPA002064, RRID:AB_1078891 | IB, 1:2000 |
| Antibody | anti-β-tubulin (Rabbit polyclonal) |
Santa Cruz | Santa Cruz Biotechnology Cat# sc-9104, RRID:AB_2241191 | IB, 1:2000 |
| Antibody | anti-pSER | Cell Signaling | Cat. #9651 | IB, 1:5000 |
| Antibody | anti-TuJ1 (Mouse monoclonal) | Covance | Covance Research Products Inc Cat# MMS-435P, RRID:AB_2313773 | IB, 1:5000 IHC, 1:5000 |
| Antibody | anti-FoxP1 (Rabbit polyclonal) |
abcam | Abcam Cat# ab16645, RRID:AB_732428 | IB, 1:1000 |
| Antibody | anti-pCREB (Rabbit monoclonal) |
Cell Signaling | Cell Signaling Technology Cat# 9198, RRID:AB_2561044 | IB, 1:1000 |
| Cell line (M. musculus) | P19 | ATCC | ATCC Cat# CRL-1825, RRID:CVCL_2153 | embryonic carcinoma cells |
| Cell line (Homo-sapiens) | HEK293T | ATCC | ATCC Cat# CRL-3216, RRID:CVCL_0063 | |
| Cell line (M. musculus) | A172L ESC | PMID: 22343290, 22039605 | ||
| Chemical compound, drug | iAKT1/2 | Sigma Aldrich | A6730 | 10 μM |
| Chemical compound, drug | SAG | Calbiochem | MER-566660 | 0.25 μM |
| Chemical compound, drug | Lipofectamine 2000 | Invitrogen | Cat. 52887 | |
| Chemical compound, drug | Superfect | Qiagen | Cat. 301307 | |
| Chemical compound, drug | SuperScript III First-Strand Synthesis System | Invitrogen | Cat. 18080085 | |
| Chemical compound, drug | SYBR-Green kit | Enzynomics | RT501S | |
| Software, algorithm | GPS 3.0 | PMID: 15980451 | http://gps.biocuckoo.cn/ |