Table 1.
Results of WGS of the choriocarcinoma and placenta
| Gene_Name | Start Position | End Position | Variant Classification | Ref | Alt | cDNA Change | Protein Change | Tumour mutant frequency | Normal mutant frequency |
|---|---|---|---|---|---|---|---|---|---|
| GIGYF2 | 233712210 | 233712230 | Inframe deletion | CAGCAGCAGCAGCTGCCACAG | - |
c.3689_3709 delTGCCACAGCA GCAGCAGCAGC |
p.Leu1230_ Gln1236del |
0.111 | 0 |
| LOC101929543 | 170064859 | 170064859 | missense_variant | G | T | c.460G>T | p.Gly154Cys | 0.108 | 0 |
| LOC101928951 | 143582475 | 143582475 | missense_variant | C | T | c.698C>T | p.Ala233Val | 0.138 | 0 |
| ANKRD20A5P | 14188003 | 14188003 | splice_acceptor_variant | G | A | n.791-1G>A | . | 0.16 | 0 |
| NBPF9 | 144823176 | 144823176 | missense_variant | C | A | c.1077C>A | p.Pro360Thr | 0.184 | 0.021 |
| C6 | 41199959 | 41199959 | missense_variant | G | T | c.356C>A | p.Ala119Glu | 0.167 | 0 |
| IQSEC3 | 176139 | 176139 | missense_variant | A | T | c.91A>T | p.Thr31Ser | 0.098 | 0 |
| IGFBP3 | 45960645 | 45960645 | missense_variant | G | C | c.95C>G | p.Ala32Gly | 0.109 | 0.021 |
The results of the WGS analysis from the tumour and placenta are shown. The results indicate a very low level of mutation within the tumour. There were no mutations in any oncogenes. The mutations noted are unlikely to be of biological importance