Table 1.
Gene and direction | Primer sequence | Base pairs | Product identitya or accession numberb |
---|---|---|---|
TRPC1 forward | ATGGGACAGATGTTACAA | 400 | NM_011643.1a |
TRPC2 forward | CGCTGGGCACTCTGCAGA | 370 | U40981b |
TRPC3 forward | AGGACATATTCAAGTTCA | 340 | NM_019510.1a |
TRPC4 forward | CAGATATCTCTGGGAAGGATG | 400 | NM_016984b |
TRPC5 forward | TTCTCTTTATCTACTGCC | 360 | NM_009428.1a |
TRPC6 forward | TTCATGGTCATATTCATC | 320 | NM_013838.1a |
All TRPC reverse | TGGAGCRAAYTTCCAYTC (R = G or A and Y = C or T) | ||
GAPDH | |||
Forward | ACCACAGTCCATGCCATCAC | 450 | NM_199472b |
Reverse | TCCACCACCCTGTTGCTGTA |
All primers are referenced to Tesfai et al. (2001).
aIdentity numbers of product sequences for isoforms detected in cells, which were obtained from the NIH–NCBI website using the BLAST protocol.
bAccession numbers for isoforms absent in cells, from which primers were designed.