Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Mus musculus) | Lmx1b | NA | MGI:1100513 | |
| Gene (M. musculus) | Pet1 | NA | MGI:2449712 | |
| Gene (M. musculus) | Tph2 | NA | MGI:2651811 | |
| Genetic reagent (M. musculus) | Pet1-Cre | PMID:16251278 | RRID:MGI:4837211 | Evan Deneris (Case Western Reserve University) |
| Genetic reagent (M. musculus) | RosaTom | Jackson Laboratory | Stock #: 007909; RRID:MGI:4436851 | Hongkui Zeng (Allen Institute for Brain Science) |
| Genetic reagent (M. musculus) | Tph2-CreERT2 | Jackson Laboratory | Stock #: 016584; RRID:IMSR_JAX:016584 | Bernd Gloss (NIEHS) |
| Genetic reagent (M. musculus) | Lmx1bflox | PMID:17151281 | RRID:MGI:3810753 | Zhou-Feng Chen (Washington University) |
| Genetic reagent (M. musculus) | Pet1flox | PMID:20818386 | RRID:MGI:4837213 | Evan Deneris (Case Western Reserve University) |
| Genetic reagent (M. musculus) | Tph2flox | PMID:24972638 | RRID:IMSR_JAX:027590 | Zhou-Feng Chen (Washington University) |
| Genetic reagent (M. musculus) | Pet1-/- | PMID:12546819 | MGI:2449922 | Evan Deneris (Case Western Reserve University) |
| Genetic reagent (M. musculus) | Pet1-YFP | PMID:16251278 | n/a | Evan Deneris (Case Western Reserve University) |
| Antibody | anti-RFP (rabbit polyclonal) | Rockland | Rockland: p/n 600-401-379; RRID:AB_2209751 | (1:200) |
| Antibody | anti-GFP (rabbit polyclonal) | Invitrogen | Invitrogen: A6455; RRID:AB_221570 | (1:200) |
| Antibody | anti-5-HT (rabbit polyclonal) | Immunostar | Immunostar: 20080; RRID:AB_1624670 | (1:200) |
| Antibody | anti-Tph2 (rabbit polyclonal) | Millipore | Millipore: ABN60; RRID:AB_10806898 | (1:500) |
| Antibody | anti-Lmx1b (rabbit polyclonal) | Suleiman et al., 2007-gift | n/a | (1:200) |
| Antibody | anti-RFP (mouse monoclonal) | Abcam | Abcam: ab65856; RRID:AB_1141717 | (1:200) |
| Antibody | anti-RFP (mouse monoclonal) | Rockland | Rockland: p/n 200-301-379; RRID:AB_2611063 | (1:200) |
| Antibody | Alexa 488- or 594- secondaries | Invitrogen | (1:500) | |
| Genetic reagent (Virus) | rAAv2/Ef1a-DIO-hchR2 (H134R)-EYFP | UNC GTC Vector Core | Lot# AV4378K | |
| Sequence-based reagent | Pcdhac2 in situ primer: F: 5’ AGCCACCTCTATCAGCTACCG 3’ | this paper | ||
| Sequence-based reagent | Pcdhac2 in situ primer: R: 5’ AGAATTAACCCTCACTAAAGGGCTCATTTTGAGAGCCAGCATCA 3’ | this paper | ||
| Sequence-based reagent | Pet1 in situ primers: F:5’CCAGTGACCAATCCCATCCTC3’ | PMID:26843655 | ||
| Commercial assay or kit | Transcriptor First Strand cDNA Synthesis Kit | Roche | REF 4896866001 | |
| Commercial assay or kit | PerfeCTa PreAmp SuperMix | QuantoBio | Cat. No. 95146–040 | |
| Commercial assay or kit | PerfeCTa FastMix II ROX mastermix | QuantaBio | Cat. No. 95119–012 | |
| Commercial assay or kit | RNA Clean and ConcentratorTM-5 kit | Zymo Research | Catalog Nos. R1015 and R1016 | |
| Chemical compound, drug | Tamoxifen | Sigma-Aldrich | CAS Number: 10540-29-1 | 10 mg/mL stock in corn oil |
| Other | 35 μm filter | BD biosciences | Cat. No. 352235 | |
| Other | Fetal bovine serum (FBS) | Gibco | Cat. No. 16000044 | |
| Other | DNase I | Invitrogen | Cat. No. 18047019 | |
| Other | Trizol LS | Invitrogen | Cat. No. 10296010 | |
| Other | TrypLE | Invitrogen | Cat. No. 12605010 | |
| Other | Leibovitz’s L15 medium | Invitrogen | Cat. No. 11415114 | |
| Commercial assay or kit | Quantifluor RNA system | Promega | Cat. No. E3310 | |
| Commercial assay or kit | Nugen TRIO RNA-seq | Nugen | Cat. No. 0507–08 | |
| Commercial assay or kit | Zymo RNA clean and concentrator | Zymo Research | Cat. No. R1013 | |
| Other | FACS Aria I | Becton Dickinson | ||
| Other | iCyt cell sorter | Sony | ||
| Other | Fragment analyzer | Advanced Analytics | ||
| Other | Nextseq 550 | Illumina | RRID:SCR_016381 | |
| Software, algorithm | FASTQC | https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ | RRID:SCR_014583 | |
| Software, algorithm | Trimmomatic | Bolger et al., 2014 | RRID:SCR_011848 | |
| Software, algorithm | Cufflinks (v2.2.2) | Trapnell et al., 2010 | RRID:SCR_014597 | |
| Software, algorithm | R (v. 3.5) | http://www.r-project.org | RRID:SCR_001905 | |
| Software, algorithm | Webgestalt | http://www.webgestalt.org | RRID:SCR_006786 | |
| Software, algorithm | Biovenn | http://www.biovenn.nl | ||
| Software, algorithm | DEXSeq | Anders et al., 2012 | RRID:SCR_012823 | |
| Software, algorithm | Tophat2 (v2.1.1) | Kim et al., 2013 | RRID:SCR_013035 | |
| Other | Mus musculus genome | Ensembl, v. 96 | RRID:SCR_002344 | |
| Other | Mus musculus genome | UCSC, mm10 | RRID:SCR_005780 | |
| Software, algorithm | featureCounts | Rsubread | RRID:SCR_012919 | |
| Software, algorithm | ENCODE Transcription Factor ChIP-seq analysis pipeline | https://github.com/ENCODE-DCC/chip-seq-pipeline | RRID:SCR_015482 | |
| Software, algorithm | Burroughs-Wheeler aligner (BWA) | http://bio-bwa.sourceforge.net/ | RRID:SCR_010910 | |
| Software, algorithm | MACS2 | Zhang et al., 2008 | RRID:SCR_013291 | |
| Software, algorithm | Imaris 7.4.2 | Bitplane, Zurich, Switzerland | Surfaces or Filament Tracer tool |